Informations

11.2 : Les molécules d'ADN ont des cartes de restriction uniques - Biologie

11.2 : Les molécules d'ADN ont des cartes de restriction uniques - Biologie



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

La séquence d'une molécule d'ADN détermine la distribution des sites de reconnaissance des ER. À partir des tailles des fragments de restriction qui sont résolus sur le gel, les chercheurs sont en mesure d'identifier la molécule d'ADN d'origine utilisée dans la digestion de restriction.

Une planification minutieuse est requise pour des cartes de restriction significatives. La première étape d'une expérience de cartographie consiste à identifier les tailles des fragments de restriction qui seront générés à partir d'une molécule d'ADN cible avec différentes ER. Une variété de programmes logiciels génèrent ces cartes de restriction et fournissent des données tabulaires avec des détails sur les longueurs et les positions des fragments de restriction dans la séquence d'ADN. La liste des enzymes qui coupent une séquence particulière est toujours impressionnante,
mais seules quelques enzymes s'avèrent généralement utilisables dans le cadre de l'expérience. Lors du choix des RE pour une carte de restriction, il y a beaucoup de choses à considérer :

  • Combien de fragments de restriction seront générés ?
  • Quelles sont les tailles prédites des fragments de restriction ?
  • Tous les fragments de restriction seront-ils clairement résolus sur des gels d'agarose à 1 % ?
  • L'ER générera-t-il un ensemble distinct de fragments à partir de chaque échantillon d'ADN ?
  • Combien coûte le RE?

Dans ce laboratoire, vous utiliserez le programme NEB Cutter pour identifier les sites REs dans les séquences plasmidiques. (NEB Cutter est fourni par New England Biolabs, un fournisseur commercial de RE.)
Vous vous souviendrez que les plasmides sont des cercles superenroulés. La digestion avec un RE ouvre un plasmide et détend sa structure. (Sans digestion RE, les tailles apparentes des plasmides sur gels d'agarose ne sont pas fiables.) Les plasmides que nous utilisons pour nos expériences sont des plasmides complexes basés sur pYES2.1 (5886 pb). Recherchez dans les résultats des ER qui généreront des fragments de restriction clairement distinguables de vos plasmides. Il est fortement recommandé de sélectionner le même RE pour les trois résumés ! Puisque les plasmides sont basés sur pYES2.1, il ne serait pas surprenant d'observer certains fragments de restriction communs dans ces produits de digestion.

Manipulation des endonucléases de restriction en laboratoire

Les ER que nous utilisons en laboratoire sont des protéines hautement purifiées (et chères !) qui ont été purifiées à partir de bactéries recombinantes. Comme toutes les enzymes, chaque RE fonctionne de manière optimale dans un ensemble défini de conditions de réaction, y compris la température, le pH et les concentrations d'ions métalliques et de sels. Le fabricant de nos ER a développé des tampons qui supportent des niveaux d'activité élevés pour plus de 200 ER. Chaque tampon contient 0,1 mg/mL d'albumine de sérum bovin (BSA), une protéine abondante du sérum de vache, qui aide à stabiliser les ER sujettes à la dénaturation et à empêcher l'absorption non spécifique des ER dans les tubes à essai et les pointes.

Comme toutes les enzymes, les ER sont sujettes à une dénaturation spontanée, les ER doivent donc être manipulées avec précaution. (Par comparaison, l'ADN est une molécule exceptionnellement stable.) Le taux de dénaturation des protéines augmente avec la température et aux interfaces air/eau. Quelques précautions simples permettront de minimiser la dénaturation. Suivez ces règles simples lorsque vous préparez les résumés de restriction :

  • Utilisez le tampon recommandé pour un RE particulier.
  • Gardez les réactions sur la glace jusqu'à ce que l'incubation commence.
  • Attention à ne pas introduire de bulles. Ne pas utiliser le mélangeur vortex.
  • Ajouter le RE en dernier, après que les autres composants du mélange réactionnel ont été assemblés.

CARACTÉRISATION MOLÉCULAIRE

Introduction

L'analyse par endonucléase de restriction (REA) du génome du mycoplasme fournit un moyen pratique et rentable de déterminer les variations de séquence d'ADN parmi les souches d'espèces mollicutes. La méthode implique la comparaison du nombre et de la taille des fragments produits par digestion de l'ADN chromosomique avec une endonucléase de restriction qui coupe l'ADN à une position constante dans un site de reconnaissance spécifique, généralement composé de 4 à 6 pb. En raison de la spécificité élevée des endonucléases de restriction, la digestion complète d'un ADN génomique donné avec une endonucléase de restriction spécifique fournit une matrice reproductible de fragments. La séparation des fragments par électrophorèse sur gel d'agarose et la coloration au bromure d'éthidium fournissent un schéma de restriction qui peut être comparé à celui des souches apparentées. Les variations dans le réseau de fragments générés par une endonucléase de restriction spécifique sont appelées polymorphismes de longueur des fragments de restriction (RFLP). Les RFLP peuvent résulter de réarrangements de séquences, d'insertion ou de suppression de segments d'ADN, ou de substitutions de bases dans les sites de clivage des endonucléases de restriction.

L'analyse des endonucléases de restriction est devenue un outil taxonomique des plus utiles, facilitant l'identification et la classification des isolats mycoplasmiques et fournissant des moyens d'évaluer le degré d'hétérogénéité génotypique des souches au sein d'espèces établies (Razin, 1989, 1991, 1992). De plus, REA fournit des informations précieuses sur le type et le nombre de séquences nucléotidiques spécifiques dans le génome, servant de base à la construction de cartes génomiques physiques ( Chapitre B4 , ce volume). Le grand avantage de la REA chromosomique est qu'elle est universellement applicable et sensible car l'ensemble du génome est évalué pour RFLP et, de plus, le test est relativement facile à réaliser. De plus, contrairement à la SDS-PAGE des protéines cellulaires mycoplasmiques, la REA n'est pas sensible à la contamination par les contaminants du milieu de culture et nécessite très peu d'ADN non marqué (3 à 5 µg) par test.


11.2 : Les molécules d'ADN ont des cartes de restriction uniques - Biologie

Tous les articles publiés par MDPI sont rendus immédiatement disponibles dans le monde entier sous une licence en libre accès. Aucune autorisation particulière n'est requise pour réutiliser tout ou partie de l'article publié par MDPI, y compris les figures et les tableaux. Pour les articles publiés sous licence Creative Common CC BY en accès libre, toute partie de l'article peut être réutilisée sans autorisation à condition que l'article original soit clairement cité.

Les articles de fond représentent la recherche la plus avancée avec un potentiel important d'impact élevé dans le domaine. Les articles de fond sont soumis sur invitation individuelle ou sur recommandation des éditeurs scientifiques et font l'objet d'un examen par les pairs avant leur publication.

L'article de fond peut être soit un article de recherche original, une nouvelle étude de recherche substantielle qui implique souvent plusieurs techniques ou approches, ou un article de synthèse complet avec des mises à jour concises et précises sur les derniers progrès dans le domaine qui passe systématiquement en revue les avancées les plus passionnantes dans le domaine scientifique. Littérature. Ce type d'article donne un aperçu des orientations futures de la recherche ou des applications possibles.

Les articles du Choix de l'éditeur sont basés sur les recommandations des éditeurs scientifiques des revues MDPI du monde entier. Les rédacteurs en chef sélectionnent un petit nombre d'articles récemment publiés dans la revue qui, selon eux, seront particulièrement intéressants pour les auteurs ou importants dans ce domaine. L'objectif est de fournir un aperçu de certains des travaux les plus passionnants publiés dans les différents domaines de recherche de la revue.


Résultats

Nous avons comparé les niveaux d'expression génique des ADN rapporteurs codant pour le gène de la luciférase de la luciole (luc-gène) avec des longueurs différentes de 1717 pb, 4331 pb et 25 690 pb ci-après, nous pouvons appeler luc1.7k, luc4.3k et luc25.7k, respectivement (Fig. 1a–c et Fig. S1 dans les informations supplémentaires). Nous avons utilisé trois conditions différentes : la même luc-concentration de gènes (Fig. 1d), la même concentration d'unités nucléotidiques (Fig. 1e) et une combinaison des deux (le même luc-concentration en gènes et en unités nucléotidiques ajustée par l'ajout d'ADN non codant, NC2.6k) (Fig. 1f). Le niveau d'expression de luc25.7k est 1000 fois plus élevé que celui avec luc1.7k, indiquant que le rendement en protéines par gène cible est multiplié par 1000 pour une matrice plus longue, luc25.7k (Fig. 1d). Sous la condition de la même concentration d'unités nucléotidiques, où les concentrations des cibles sont inversement proportionnelles à la longueur des molécules d'ADN (Fig. 1e), le niveau d'expression de luc25.7k est le plus élevé malgré le fait que luc25.7k a le moins de cibles. Fait intéressant, dans une comparaison de luc1.7k et luc4.3k, luc4.3k a induit une augmentation de 7 fois (Fig. 1d) et de 2 fois (Fig. 1e) du niveau d'expression génique, respectivement. Ces résultats indiquent que la suppression d'une région non codante de 2,6 kb entraîne un rendement en protéines inférieur, c'est-à-dire que l'amplitude de l'expression génique augmente lorsque la région codant pour la luciférase est connectée à la région non codante. Pour valider ce résultat, le niveau d'expression génique a été comparé à la condition que la quantité de luc-gène et la concentration en nucléotides ont été unifiées par l'ajout de NC2.6k au tampon de réaction (Fig. 1f). On montre que l'ajout de NC2.6k à luc1.7k et luc4.3k a provoqué des rendements en protéines d'un ordre de grandeur plus élevés (Fig. 1d,f), suggérant l'effet intrinsèque de la concentration en nucléotides sur l'efficacité de l'expression génique. Néanmoins, il est clair que l'efficacité d'expression par cible est significativement améliorée lorsque la longueur de la molécule d'ADN matrice est plus longue (Fig. 1f).

Effets de divers facteurs sur l'efficacité de l'expression des gènes. (une,b) Diagramme schématique des ADN plasmidiques parentaux de 4,3 kpb et 25,7 kpb. La case blanche sur l'ADN plasmidique représente un gène rapporteur de luciférase de luciole avec un promoteur T7. La flèche rouge dans la case blanche montre la direction de la transcription du gène rapporteur. (c) Fragments d'ADN résultant de la digestion par Sal I du plasmide parental de 25,7 kpb ou de l'amplification PCR. Sal I donne un seul gène rapporteur linéaire de 25,7 kpb. Un gène rapporteur de 1,7 kpb, un gène rapporteur de 4,3 kpb et un fragment d'ADN non codant de 2,6 kpb ont été préparés par PCR standard. Le gène rapporteur linéaire de 25,7 kpb et la région d'ADN non codante de 2,6 kpb sont respectivement colorés en rouge et en gris. (F) Efficacité, je, de la réaction couplée transcription/traduction de luc-gène, tel qu'évalué à partir du changement d'intensité de luminescence. Le même luc-concentration génique (0,12 M, ), la même concentration en unités nucléotidiques (1,8 M, e), ou une combinaison des deux (le même luc-concentration en gènes et en unités nucléotidiques) (0,12 µM et 1,8 µM, F) des gènes rapporteurs. Dans (d–f), l'axe longitudinal montre l'intensité relative de luminescence normalisée à celle de luc25,7 k. Les niveaux relatifs d'expression des protéines avec luc25,7 k sont présentés comme des moyennes ± SD d'au moins cinq expériences indépendantes.

Les résultats ci-dessus indiquent clairement que le niveau d'expression génique a nettement augmenté en réponse à une augmentation de la longueur des matrices, en plus de l'effet de la concentration en nucléotides dans la solution tampon de réaction. Il est révélé que la puissance d'expression est de l'ordre de luc25.7k > luc4.3k > luc1.7k dans toutes les conditions testées ici (Fig. 1). Cela ne dépend pas du nombre de cibles, mais plutôt de la longueur de l'ADN matrice. Ces résultats suggèrent également que la région non codante des ADN rapporteurs est impliquée dans la régulation de l'expression des gènes.

La conception des ADN linéaires illustrés à la figure 1 peut ne pas être suffisamment convaincante pour étudier l'influence de la longueur de l'ADN sur l'expression des gènes, car les séquences non spécifiques des flux amont et aval du promoteur de l'ARN T7 sont différentes dans chaque gène. Pour répondre à la préoccupation dans la conception expérimentale, nous avons ensuite conçu un test de traduction in vitro avec quatre types de gènes rapporteurs de différentes longueurs de nucléotides. Les quatre ADN rapporteurs codant pour la luciférase de luciole avec un promoteur T7 ont été obtenus à partir d'un ADN plasmidique identique de 25,7 kpb clivé avec l'enzyme de restriction Sal I, Afl II, Aat II ou ApaL I, respectivement (Fig. 2a). Sal I produit un seul gène rapporteur linéaire de 25,7 kpb, et les autres enzymes génèrent des gènes rapporteurs de différentes longueurs avec des fragments d'ADN non codants (Fig. 2b). Les mélanges d'ADN résultants avec des gènes rapporteurs de différentes longueurs (ApaLI 2.8k, AatII 3.3k, AflII 11.2k et luc25.7k) ont été utilisés pour évaluer leur efficacité traductionnelle en tant que matrices d'ADN pour la transcription/traduction couplée continue. Comme prévu, l'expression du gène rapporteur a augmenté d'une manière dépendante de la longueur des nucléotides sur les matrices d'ADN tandis que la quantité et la composition des nucléotides sont restées identiques dans chaque réaction (Fig. 2c,d). Ces résultats suggèrent fortement que la longueur de l'ADN affecte positivement les activités des gènes dans un système d'expression génique acellulaire.

Dépendance de la longueur des nucléotides de la transcription/traduction couplée du luc-gène. (une) Diagramme schématique de l'ADN plasmidique parental de 25,7 kpb avec des sites de digestion par enzyme de restriction. La case blanche sur l'ADN plasmidique représente un gène rapporteur de luciférase de luciole avec un promoteur T7. La flèche rouge dans la case blanche montre la direction de la transcription du gène rapporteur. (b) Fragments d'ADN résultant de réactions de digestion enzymatique du plasmide parental. Sal I donne un seul gène rapporteur linéaire de 25,7 kpb. Afl II, Aat II et ApaL I génèrent un gène rapporteur de 11,2 kpb et trois types de fragments d'ADN non codants de 4,8 kpb, un gène rapporteur de 3,3 kpb et cinq types de fragments d'ADN non codants (7 pb, trois 4,8 longueurs -kpb et 7,9 kbp), et un gène rapporteur de 2,8 kbp et quatre types de fragments d'ADN non codants (20,7 kbp, 1,2 kbp et deux longueurs de 0,5 kbp), respectivement. Les gènes rapporteurs dans les fragments d'ADN sont colorés en rouge pour Sal I, orange pour Afl II, vert pour Aat II et bleu clair pour les traitements ApaL I, respectivement. (c,) Efficacité, je, de la réaction couplée transcription/traduction de luc-gène, tel qu'évalué à partir de l'intensité de luminescence. 2,5 ng (c) et 15 ng () de mélanges d'ADN digérés ont été utilisés comme matrices d'ADN pour la réaction. Dans (c,), l'axe longitudinal montre l'intensité relative de luminescence normalisée à celle de luc25.7k. Les niveaux relatifs d'expression des protéines avec luc25,7k sont présentés comme des moyennes ± SD d'au moins cinq expériences indépendantes.

Pour déterminer l'effet de la taille du gène rapporteur sur l'activité d'expression génique, des observations d'une seule molécule de chaque gène rapporteur linéaire ont été effectuées par AFM. Les images AFM de chaque ADN dans un tampon Tris-HCl 10 mM (pH 7,5) ont révélé une structure linéarisée, indiquant que les molécules d'ADN ont tendance à présenter une structure plus sinueuse à mesure que leur longueur augmente (Fig. 3a). Notamment, dans un mélange réactionnel à 0,05 % pour l'expression génique in vitro, luc25.7k ont ​​formé une structure rétrécie avec une densité de segments d'ADN plus élevée que celle de luc4.3k et luc1.7k (Fig. 3b et Fig. S2 dans les informations supplémentaires). Sur la base de ces observations, nous considérons que les comportements de glissement et de saut de l'ARN polymérase, qui ont été largement étudiés, sont améliorés avec un ADN plus long. De plus, les protéines coexistant dans le tampon de réaction d'expression génique ont tendance à se localiser sur la conformation rétrécie pour les molécules d'ADN plus grosses, ce qui suggère que l'affinité effective de l'ARN polymérase pour l'ADN est améliorée dans l'ADN plus long (voir les représentations schématiques sur les images inférieures de la Fig. .3b). Dans la discussion suivante, nous pouvons argumenter le mécanisme sur la promotion de l'expression des gènes en relation avec les caractéristiques physico-chimiques des molécules d'ADN plus longues.

Images AFM d'ADN rapporteurs de différentes longueurs avec les représentations schématiques. (une) Images AFM de chaque ADN rapporteur linéaire dans un tampon Tris-HCl 10 mM (pH 7,5). (b) Images AFM de chaque ADN rapporteur linéaire dans un mélange réactionnel à 0,05 % pour l'expression génique in vitro.

Les cellules régulent l'expression des gènes pour maintenir les fonctions cellulaires. L'expression des gènes commence par la transcription et est continuellement suivie d'événements de traduction. Par conséquent, l'initiation de la transcription est un point efficace pour contrôler la production de protéines. Dans la présente étude, nous avons démontré que la longueur de l'ADN est un facteur crucial pour l'expression des gènes en utilisant un système couplé de transcription/traduction. Les effets positifs de la longueur de l'ADN sur l'efficacité de l'expression des gènes peuvent s'expliquer principalement par une activité de transcription accrue, tandis que la stabilité de l'ARNm, l'activité des nucléases et la dégradation de la matrice doivent également être prises en compte. En fait, il est apparu que l'ARNm était légèrement moins stable que l'ARN ribosomique lorsque la stabilité de l'ARNm dans les lysats de cellules de réticulocytes a été examinée par RT-qPCR (tableau S1 dans les informations supplémentaires). Pendant ce temps, il est à noter que les longueurs et les stabilités des transcrits de chaque gène rapporteur sur la figure 2 sont les mêmes que celles du nucléotide du promoteur T7 à son terminateur. Il est donc considéré que la phase de traduction n'est pas impliquée dans le contrôle de l'expression génique dans les présentes expériences dans un système acellulaire.


Fréquences des sites de restriction

Le tableau ci-dessous résume les fréquences auxquelles les sites d'endonucléase de restriction apparaissent dans les molécules d'ADN couramment utilisées. Des cartes de restriction détaillées peuvent être trouvées sur les séquences d'ADN et les cartes. Les sites répertoriés dans ces tableaux ont été identifiés par analyse informatique des séquences publiées. Bien que nous ayons essayé de nous assurer de leur exactitude, les sites n'ont pas nécessairement été confirmés par l'expérimentation. Lorsque la même spécificité est affichée par plusieurs enzymes, le site est répertorié par le nom de l'enzyme disponible auprès de New England Biolabs. D'autres enzymes ayant la même spécificité sont répertoriées dans le tableau des isoschizomères. Les séquences de reconnaissance sont écrites 5´ à 3´.

DNASU est un référentiel central pour les clones et les collections de plasmides qui peuvent également être utiles.

Enzyme Séquence de reconnaissance Adéno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII § GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI § CNNNNNNNNNNN/NNNNNNNNNG
AccI § GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I § G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI § CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
ACLI § AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI § CTGAAG (16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI § AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII § C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII § A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
ÂgeI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI § GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 § CACNN/NNTGG 10 20 1 0 1 0 1 0 2 0 8
AluI § AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI § GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI § CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
ApaI § GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApaLI § G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI § G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI § GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI § AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI § GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI § C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII § G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII § C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI § GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI § (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI § G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII § GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI § CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI § GCAGC (8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI § CCCAT(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI § ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI § (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI § GTATCC (6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI § CGV(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI § C/ÉTIQUETTE 54 13 5 5 19 3 14 8 8 4 60
BfuAI § ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI § GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII § A/AGCT 11 6 1 0 1 1 2 0 2 0 1
BlpI § GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI § CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI § ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI § CTGGAG (16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI § CTTGAG (16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I § CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI § YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI § GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI § GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 § GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI § C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI § Avec CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI § (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI § GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI § CCCACG(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI § GTGCAG (16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI § CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI § GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI § CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI § CGV(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 § CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI § GGGAC (10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI § GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI § C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI § CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI § AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI § T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI § T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I § GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI § ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI § GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI § CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI § GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 § R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI § ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII § G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 § CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI § GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI § TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® § G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI § CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI § CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI § CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI § R/GACY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® § GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I § CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI § C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI § GCGATG (10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI § GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI § CAGTG(2/0) 20
BtsI-v2 § GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I § GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI § AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI § (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII § C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 § RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI § G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI § C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI § AG/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII § /GATC 87 116 6 22 35 23 31 24 29 15 6
Tirer § TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® § CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI § GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaI § Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® § C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EARI § CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI § GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI § BAG/CCT 16 2 1 0 2 1 2 0 1 1 0
EcoNI § CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I § RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I § CAGCAG (25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® § CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I § CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI § /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI § CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI § GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI § GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI § GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI § CC (12/16)
FspI § TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII § RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII § GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI § GACGC (5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI § GCG/C 375 215 26 31 36 39 41 46 17 103
HincII § GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI § G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I § G/CGC 375 215 26 31 36 39 27 41 46 17 103
Hpal § GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII § C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI § GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV § CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III § ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV § A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V § TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I § TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I § CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II § GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III § TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI § TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI § TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI § G/GCCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI § CCDG (10/14)
MboI § /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII § GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI § /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® § A/CGGCT 5 7 0 0 0 1 2 2 1 0 1
MlyI § GAGTC (5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI § TCCRAC (20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI § CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI § TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI § T/AAT 115 195 63 15 41 24 23 32 39 13 207
MslI § CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I § CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI § C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI § CNNR(9/13)
MwoI § GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI § GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI § GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI § CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI § GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI § GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI § CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI § GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI § CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI § CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV § G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® § G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII § CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV § GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII § GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NonI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI § RCATG/O 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI § GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI § CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI § CGV(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI § GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI § GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII § (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI § TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I § C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI § CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCI § A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI § GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI § CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI § TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI § ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI § GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI § GGCGC/C
PmeI § GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI § CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI § RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI § GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 § TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI § /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI § G/CCGGCC 12 1 0 0 0 1 1 1 1 0 0
PspXI § VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® § CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
Rsal § GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII § CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII § CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI § GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI § /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I § G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® § AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI § CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI § A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI § GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI § C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI § GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI § GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI § CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI § CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI § C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI § TAC/RGT 0 1 1 0 1 0 1 0 0 0 13
SpéI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI § GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI § AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I § /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® § C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI § ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 § T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI § G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI § G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I § /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI § C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI § NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I § GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI § T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI § CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI § C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
Noël § C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI § GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI § CAG/CG 3 10 0 1 0 0 5 1 0 1 1

§ Une version HF de cette enzyme est disponible.

* Pour M13mp18, seules les régions double brin seront coupées.
** Fait référence au substrat d'ADN de type sauvage. Hind III a 6 sites de restriction sur l'ADN du phage lambda de type sauvage, tandis que le mutant du phage lambda de NEB (ADN Lambda, NEB #N3011) a 7 sites Hind III.


Tout ce que vous avez toujours voulu savoir sur les enzymes de restriction de type II

A quoi servent les enzymes de restriction de type II ?

Les enzymes de restriction de type II sont celles qui sont bien connues pour les applications de biologie moléculaire quotidiennes telles que le clonage de gènes et la fragmentation et l'analyse de l'ADN. Ces enzymes clivent l'ADN à des positions fixes par rapport à leur séquence de reconnaissance, créant des fragments reproductibles et des modèles d'électrophorèse sur gel distincts. Plus de 3 500 enzymes de type II ont été découvertes et caractérisées, reconnaissant quelque 350 séquences d'ADN différentes. Des milliers d'autres enzymes de type II ont été identifiées par l'analyse de génomes bactériens et archéens séquencés, mais restent non caractérisées.

Comment les enzymes de restriction de type II sont-elles nommées ?

Les enzymes de restriction sont nommées en fonction du micro-organisme dans lequel elles ont été découvertes. L'enzyme de restriction &lsquoHindIII&rsquo, par exemple, est la troisième de plusieurs activités endonucléases trouvées dans la bactérie Haemophilus influenzae sérotype d. Le préfixe &lsquoR.&rsquo est parfois ajouté pour distinguer les enzymes de restriction des enzymes de modification avec lesquelles elles s'associent in vivo. Ainsi, &lsquoR.HindIII&rsquo se réfère spécifiquement à l'enzyme de restriction, et &lsquoM.HindIII&rsquo à l'enzyme de modification. Lorsqu'il n'y a pas d'ambiguïté, le préfixe &lsquoR.&rsquo est omis.

Propriétés des enzymes de restriction de type II

Les enzymes de restriction de type II sont très diverses en termes de séquence d'acides aminés, de taille, d'organisation de domaine, de composition de sous-unités, d'exigences en cofacteur et de modes d'action. Ils sont grossièrement classés en une douzaine de sous-types selon leur comportement enzymatique. Il s'agit d'une classification pratique qui reflète leurs propriétés plutôt que leur phylogénie. Il ne reflète pas nécessairement des relations évolutives ou structurelles, et les sous-types ne s'excluent pas mutuellement. Une enzyme peut appartenir à plusieurs sous-types si elle présente chacune des caractéristiques qui la définissent. Nous discutons de ces sous-types dans leur ordre d'importance, les quatre principaux sont les types IIP, IIS, IIC et IIT.


Question : Semaine 10 - Enzyme de restriction Questions post-laboratoire 1- Dans le laboratoire d'aujourd'hui, vous avez purifié l'ADN plasmidique d'E. coli. Quels types de molécules sont présentes dans l'E. coli avec lequel vous avez commencé ? a) Après la purification, quels types de molécules pensez-vous avoir dans votre échantillon ? b) Quelle enzyme de restriction avez-vous utilisé pour

1- Dans le laboratoire d'aujourd'hui, vous avez purifié l'ADN plasmidique d'E. coli. Quels types de molécules sont présentes dans l'E. coli avec lequel vous avez commencé ?

a) Après la purification, quels types de molécules pensez-vous avoir dans votre échantillon ?

b) Quelle enzyme de restriction avez-vous utilisée pour le digest aujourd'hui ?

c) Quelle(s) taille(s) de fragments d'ADN vous attendez-vous à obtenir de la digestion par les enzymes de restriction si vos bactéries contiennent le plasmide sans insert ?

d) Quelle(s) taille(s) de fragments d'ADN vous attendez-vous à obtenir de la digestion par les enzymes de restriction si vos bactéries contiennent le plasmide avec le gène d'intérêt ?

e) Sur la base de ce que vous savez sur le fonctionnement des enzymes de restriction, expliquez pourquoi vous êtes capable de prédire les tailles d'ADN qui seront obtenues à partir de cette expérience.

Ce sont mes notes de laboratoire de la section protocole.

Veuillez répondre clairement à toutes les questions. J'ai téléchargé tout ce dont vous avez besoin pour répondre aux questions.


Test génétique

Les maladies génétiques sont traditionnellement diagnostiquées par des critères cliniques ou des tests biochimiques. Le diagnostic clinique est souvent ambigu car les caractéristiques spécifiques d'un trouble peuvent prendre des années à se développer. Les tests biochimiques utilisés pour détecter la présence ou l'absence d'un produit génique peuvent donner des résultats équivoques de plus, les tests prénatals et l'identification d'un état de porteur sont souvent difficiles. Avec l'avènement de nouvelles techniques moléculaires, des gènes spécifiques et des mutations génétiques peuvent désormais être identifiés bien avant l'apparition des symptômes cliniques. Un autre avantage des nouveaux tests de diagnostic basés sur la biologie moléculaire est que ces tests ne nécessitent qu'un petit échantillon d'ADN (comme celui trouvé dans un seul tube de sang) au lieu de biopsies tissulaires. En raison de ces avantages, les tests génétiques moléculaires sont devenus monnaie courante.

Technique

Les tests génétiques utilisent l'analyse des enzymes de restriction, l'hybridation d'ADN et d'ARN et la PCR (seule ou en combinaison) pour détecter des mutations ponctuelles subtiles, des délétions ou des insertions d'ADN. Les mutations de décalage du cadre de lecture (où un acide nucléique est ajouté ou supprimé, provoquant le décalage du code triplet), l'arrêt prématuré de la traduction (entraînant une protéine anormalement petite) et l'insertion de multiples répétitions de séquences non-sens, sont des mutations plus susceptibles d'être pathogènes que mutations simples de paires de bases. Les mutations qui impliquent le simple changement d'un acide aminé pour un autre peuvent ou non avoir une signification clinique. L'effet d'un changement d'acide aminé peut être prédit sur la base de la structure de la protéine, ou il peut être nécessaire de reproduire le nouveau phénotype en culture cellulaire ou même dans un modèle animal pour prouver la pathogénicité de la substitution. Les modifications d'un seul acide aminé sans conséquence biologique observable sont appelées polymorphismes bénins et sont assez courantes dans la population générale. Par conséquent, les généticiens doivent être capables de distinguer les mutations pathogènes des polymorphismes non pathogènes, une tâche souvent difficile. Cette différenciation est simple dans une maladie telle que la drépanocytose, qui est homogène, en ce que tous les patients atteints de la maladie ont une valine substituée à l'acide glutamique sur le gène de la bêta-globine dans l'hémoglobine. Cependant, les tests génétiques sont compliqués car de nombreuses maladies héréditaires ne sont pas le résultat d'une seule mutation, mais plutôt de multiples mutations, toutes résultant en le même phénotype. Par exemple, 70 % des Européens du Nord atteints de mucoviscidose ont une délétion de trois paires de bases qui entraîne la perte de l'acide aminé phénylalanine du régulateur de la conductance transmembranaire de la mucoviscidose. [25]Il est possible de dépister cette délétion et de diagnostiquer les patients porteurs de cette mutation (Figure 8). Cependant, les 30 % restants des personnes atteintes de mucoviscidose ont plus de 200 mutations différentes qui entraînent des phénotypes similaires. [26] Cette hétérogénéité se produit dans de nombreuses maladies héréditaires et, par conséquent, un test négatif pour une mutation spécifique n'exclut pas la possibilité de la maladie, mais uniquement de la mutation spécifique.

Figure 8. La délétion de 3 paires de bases dans la mucoviscidose. La mutation implique la suppression de CTT dans le dixième exon du gène. La séquence de gauche provient d'un individu sain et la séquence de droite d'un patient atteint de mucoviscidose. Cette délétion de 3 paires de bases entraîne la perte de phénylalanine de la protéine. (Réimprimé avec autorisation : Watson J, Gilman M, Witkowski J, Zoller M : Recombinant DNA. New York, W. H. Freeman and Co., 1992, p. 530.)

Figure 8. La délétion de 3 paires de bases dans la mucoviscidose. La mutation implique la suppression de CTT dans le dixième exon du gène. La séquence de gauche provient d'un individu sain et la séquence de droite d'un patient atteint de mucoviscidose. Cette délétion de 3 paires de bases entraîne la perte de phénylalanine de la protéine. (Réimprimé avec autorisation : Watson J, Gilman M, Witkowski J, Zoller M : Recombinant DNA. New York, W. H. Freeman and Co., 1992, p. 530.)

Un autre problème avec les tests génétiques actuels est que de très petites délétions ou ajouts dans l'ADN qui sont responsables de la maladie restent extrêmement difficiles à identifier. Même de grandes délétions qui impliquent de longues séquences d'ADN peuvent parfois être difficiles à détecter. C'est parce que les chromosomes non sexuels viennent par paires, de sorte que même un défaut important dans un gène peut être masqué par un deuxième gène normal. Bien que le gène normal doive produire la bande d'hybridation attendue sur un Southern blot, et que cette bande doive être moins intense que si deux gènes normaux sont présents, l'analyse quantitative par Southern blot est difficile et seulement relative au mieux. Ces problèmes aident à expliquer pourquoi, même si de nombreux gènes et mutations ont été identifiés comme importants dans diverses maladies et que les tests génétiques sont devenus monnaie courante, jusqu'à présent, relativement peu de tests de diagnostic diagnostiquent sans équivoque la maladie.

Nouvelles approches

L'identification d'une mutation spécifique responsable d'une maladie donnée facilite les tests génétiques. Cependant, lorsque la mutation spécifique n'est pas connue, le test direct n'est pas possible. Dans cette situation, des techniques alternatives telles que l'analyse de liaison peuvent s'avérer utiles. L'analyse de liaison peut être utilisée dans les familles où des séquences d'ADN spécifiques (marqueurs) sont toujours trouvées chez les individus atteints de la maladie, mais pas chez ceux qui n'en sont pas atteints. [27] Pour certaines maladies, au sein d'une famille donnée, les marqueurs sont toujours hérités avec la maladie, même si la séquence exacte des marqueurs ADN peut varier d'un membre de la famille à l'autre. Les difficultés impliquées dans l'analyse de liaison sont que deux générations ou plus de membres de la famille affectés sont nécessaires pour l'étude, et les marqueurs pour chaque individu doivent être déterminés séparément. De plus, lorsqu'un gène a une faible influence sur l'expression de la maladie, davantage de familles doivent être étudiées pour tirer des conclusions significatives. Par conséquent, l'analyse de liaison ne peut pas être effectuée chez un seul membre de la famille affecté ou lorsque les parents ne coopèrent pas. L'analyse de liaison a été utilisée dans les familles pour diagnostiquer la dystrophie musculaire de Duchenne, l'hémophilie et l'amyotrophie spinale. [28-30]Malheureusement, de nombreuses maladies, telles que la schizophrénie, l'obésité sévère et le diabète, sont multifactorielles et ne peuvent pas encore être dépistées, même en utilisant une analyse de liaison.

Deux nouvelles méthodes ont été développées pour examiner le génome entier au lieu de marqueurs individuels. L'analyse des différences de représentation compare les différences entre deux génomes, tandis que le balayage des mésappariements génomiques (GMS) identifie des séquences identiques entre deux échantillons. L'analyse des différences de représentation utilise des techniques d'hybridation pour sélectionner des régions d'ADN qui diffèrent les unes des autres. [31]Cependant, cette méthode nécessite que presque chaque fragment s'hybride à un fragment d'ADN complémentaire. Le génome humain est si grand que l'analyse des différences de représentation peut prendre des semaines. L'analyse des mésappariements génomiques sélectionne l'ADN de parents affectés de familles non apparentées pour identifier des séquences de gènes similaires.[32] Le concept sous-jacent est qu'une paire de parents aura de nombreuses zones similaires dans leur génome, mais en examinant les génomes d'individus affectés de familles non apparentées, il devrait y avoir des régions systématiquement identiques d'une famille à l'autre. Ces régions seraient liées au gène de la maladie. Ces deux méthodes offrent de nouvelles promesses dans la cartographie et l'identification des maladies héréditaires.

Préoccupations éthiques

La capacité à dépister les maladies génétiques soulève de nombreuses questions éthiques, notamment l'impact psychologique du dépistage sur les patientes, les conséquences des résultats sur les prestations d'assurance maladie et l'emploi et, in fine, les décisions prises qui résultent des informations obtenues par le dépistage prénatal. Pour répondre à ces questions éthiques, 3 % du budget du Projet du génome humain a été alloué à l'exploration et à la préparation des conséquences sociales, juridiques et éthiques de la cartographie du génome humain. Lorsque le dépistage de plusieurs maladies génétiques sera disponible, des décisions difficiles seront nécessaires quant à savoir qui tester et si ces personnes souhaitent être testées. Les informations obtenues grâce au dépistage doivent être utilisées avec précaution et uniquement dans le contexte approprié, bien que les tests moléculaires puissent identifier la présence d'un gène défectueux, cela ne prouve pas que la maladie surviendra, ni ne donne une idée de l'âge d'apparition de la maladie, le rôle que l'environnement peut jouer, ou la gravité de la maladie chez un individu spécifique. Tous ces problèmes ont le potentiel d'avoir un impact sur la société en termes de chômage, d'éducation, de prestations d'assurance et de la façon dont nous nous considérons les uns les autres (c'est-à-dire comme supérieurs ou inférieurs). L'enfant à naître peut également être affecté, les résultats des tests génétiques prénatals influençant si une aberration génétique donnée est jugée acceptable, ou même le désir potentiel des parents de choisir des attributs spécifiques pour leur progéniture (de la couleur des cheveux à l'intelligence au sexe). Par conséquent, il reste impératif que, parallèlement aux progrès de notre compréhension du génome humain, les travaux se poursuivent dans les domaines de l'éthique et de la sociologie pour aider les nouvelles informations résultantes à être utilisées de la meilleure façon possible pour le bien général de l'humanité.


Discussion

Actuellement, il est difficile de détecter des SV volumineux ou complexes à partir du séquençage seul, et encore plus difficile d'estimer les tailles de SV, en raison de la courte longueur de lecture et de la taille d'insertion limitée entre les paires de lecture. En particulier, les insertions volumineuses sont particulièrement difficiles à détecter pour les méthodes d'appel SV basées sur des lectures courtes, car l'alignement des lectures de support qui contiennent des contenus non dans la référence est difficile et la couverture de lecture n'est supprimée que localement autour du site d'insertion. Le fait d'avoir des éléments répétés autour des points d'arrêt SV pourrait également rendre difficile la détection de SV à partir de lectures de séquençage courtes. En revanche, en utilisant des cartes optiques basées sur des nanocanaux, des SV entiers sont facilement contenus dans une seule carte optique, ce qui rend la détection de SV hautement réalisable et précise. Ici, nous avons démontré qu'OMSV est un outil puissant pour identifier les grandes SV, allant de kilobases à plus d'une centaine de kilobases. En fait, tant qu'une carte optique peut être correctement alignée sur la référence en ayant suffisamment de sites d'entaille dans les parties flanquantes non-SV, plus un SV est grand, plus il est facile pour OMSV de le détecter, car la distance correspondante change entre les sites de coupure définis est moins probable en raison des seules erreurs de mise à l'échelle et de mesure. Cette propriété fait d'OMSV un complément idéal aux appelants SV basés sur le séquençage, qui sont généralement plus précis pour détecter les SV plus petits.

L'OMSV détecte les régions complexes et les très grandes SV avec une stratégie d'alignement à deux tours qui permet l'alignement divisé d'une carte optique à plusieurs emplacements sur le génome. Les alignements fractionnés de cartes optiques pourraient entraîner un coût de temps d'alignement supplémentaire. Une façon de résoudre ce problème est d'abord d'aligner rapidement des cartes optiques qui peuvent être alignées sur des loci génomiques uniques à l'aide d'un aligneur standard, puis d'appliquer la stratégie d'alignement divisé uniquement aux cartes optiques non alignées restantes.

Étant donné que les modules d'appel SV ne nécessitent qu'une liste d'alignements de cartes optiques en entrée, les méthodes d'alignement utilisées dans le pipeline OMSV peuvent être modifiées de manière flexible pour d'autres choix. En outre, si un assemblage de novo de haute qualité des cartes optiques est disponible, les cartes optiques peuvent également être d'abord alignées sur l'assemblage, et leur alignement sur la référence peut alors être déduit d'un alignement ultérieur de l'assemblage sur la référence. Pour les cartes optiques qui s'écartent considérablement de la carte de référence, cette stratégie d'alignement en deux étapes pourrait être plus précise que l'alignement direct des cartes optiques sur la référence.

Avec chaque carte optique provenant d'une molécule d'ADN, l'OMSV peut potentiellement être étendu pour étudier les haplotypes, la composition du type cellulaire dans un échantillon et la variabilité de cellule à cellule. Ces analyses nécessiteraient des alignements très précis des étiquettes individuelles des cartes optiques. Sonder les sites d'entaille d'une seconde enzyme à l'aide d'un canal de couleur supplémentaire peut encore améliorer la précision d'alignement nécessaire pour ces analyses. Avec une telle précision améliorée, nous espérons également étendre OMSV pour appeler la zygosité des SV complexes.


Séquences répétées, dont la plupart sont dérivées d'éléments transposables. Ces séquences sont propagées en insérant de nouvelles copies d'elles-mêmes dans des sites aléatoires du génome.

Le marquage épigénétique d'un locus sur la base de l'origine parentale, qui se traduit par l'expression d'un gène monoallélique.

Chromatographie en phase liquide à haute performance

(HPLC). Technique de séparation de molécules d'ADN ou de protéines par poids moléculaire et conformation. Les molécules sont résolues par des différences dans leur distribution entre une phase stationnaire et une phase mobile. La résolution est augmentée en augmentant la pression du système.

Électrophorèse capillaire haute performance

(HPCE). Une classe de techniques de séparation qui utilisent des capillaires de silice fondue à alésage étroit pour séparer un mélange complexe de composés chimiques. Les molécules sont séparées sur la base de différences de charge, de taille, de structure et de potentiel hydrophobe à l'aide de champs électriques puissants.

Ce test de méthylation de l'ADN implique une modification initiale de l'ADN par du bisulfite de sodium, convertissant toutes les cytosines non méthylées, mais non méthylées, en uracile, et une amplification ultérieure avec des amorces spécifiques de l'ADN méthylé par rapport à l'ADN non méthylé.

Méthode d'électrophorèse sur gel dans laquelle les protéines d'un échantillon sont séparées par leurs points isoélectriques dans une dimension et par taille dans une seconde dimension perpendiculaire.

Un test de méthylation quantitative à haut débit qui utilise la technologie de PCR en temps réel basée sur la fluorescence (TaqMan) et ne nécessite aucune autre manipulation après l'étape de PCR. Cette technique est réalisée en combinaison avec un traitement au bisulfite (dans lequel les résidus de cytosine non méthylés sont convertis en uracile), et la discrimination de séquence est réalisée en concevant les amorces pour chevaucher les sites potentiels de méthylation de l'ADN (dinucléotides CpG).

Une méthode de séquençage de l'ADN dans laquelle la lumière est émise à la suite d'une réaction enzymatique, chaque fois qu'un nucléotide est incorporé dans la chaîne d'ADN en croissance. Appliquée à la détection de la méthylation, la variation de séquence d'ADN dépendante de la méthylation, obtenue par traitement au bisulfite de sodium, est traitée comme une sorte de SNP de type C-T et est soumise à un typage SNP conventionnel.

Amplification de l'ADN génomique à l'aide d'amorces arbitraires. Les premiers cycles d'amplification sont réalisés à basse température d'hybridation, de sorte que l'amorce s'hybride à de nombreuses séquences non spécifiques. La température est ensuite augmentée, de sorte que seuls les « meilleurs » produits des événements d'annelage initiaux sont encore amplifiés, générant un certain nombre de bandes discrètes qui fournissent une empreinte digitale du génome.

Amplification des sites interméthylés

(AIMS). Une technique d'empreintes digitales de méthylation d'ADN qui utilise des isoschizomères de méthyle et une amplification PCR arbitraire pour obtenir de nombreuses bandes anonymes, qui représentent des séquences d'ADN flanquées de deux sites méthylés.

(Ébrécher). L'isolement, à l'aide d'anticorps spécifiques, de fragments de chromatine liés par un facteur nucléaire particulier ou associés à une signature de modification d'histone particulière. L'ADN immunoprécipité peut ensuite être analysé avec des amorces PCR spécifiques.

Combinaison d'immunoprécipitation de la chromatine et d'hybridation à des puces à ADN génomiques utilisée pour identifier des séquences d'ADN liées à un facteur nucléaire particulier ou avec un profil de modification d'histone spécifique.

(Immunoprécipitation d'ADN méthylé). Immunoprécipitation avec des anticorps anti-5-méthylcytosine suivie d'une hybridation sur puces génomiques, permettant l'identification de séquences riches en méthyl-CpG.

Microarrays qui contiennent un ensemble d'oligonucléotides qui se chevauchent ou d'autres sondes qui couvrent soit l'ensemble du génome, soit, pour une approche plus spécialisée, une sous-région d'intérêt.

Une technique analytique déterminant la masse moléculaire. Cela implique une source d'ions dans laquelle des ions moléculaires en phase gazeuse sont produits à partir des molécules d'analyte, un analyseur de masse dans lequel des champs électriques et/ou magnétiques sont utilisés pour séparer les ions d'analyte par leurs différents rapports masse/charge, et un détecteur pour enregistrer les ions séparés.

Chromatographie liquide-spectrométrie de masse électrospray

Technique de spectrométrie de masse dans laquelle l'ionisation des molécules est effectuée dans des aérosols de petites gouttelettes. Les molécules sont ensuite identifiées à l'aide de champs électriques et magnétiques.

Un système analytique dans lequel deux spectromètres de masse liés sont utilisés pour mesurer de petites quantités de métabolites. Les analytes sont séparés selon leur masse et leur charge. En programmant l'instrument pour qu'il ne réponde qu'à certaines masses, un degré élevé de spécificité et de sensibilité peut être atteint.

Une croissance cellulaire d'origine glandulaire, qui peut provenir d'organes tels que le côlon et les glandes surrénales, hypophysaires et thyroïdiennes. Ces excroissances sont bénignes, mais certaines sont connues pour avoir le potentiel, au fil du temps, de se transformer en tumeur maligne (à quel point elles deviennent connues sous le nom d'adénocarcinome.)

Un diagramme en arbre qui représente les similitudes relatives entre différents échantillons correspondant à des patients humains en termes de prédiction des résultats. Les échantillons regroupés dans la même branche du dendrogramme ont les mêmes marqueurs pronostiques (par exemple, âge, stade, délétions ou gains chromosomiques, ou expression génique spécifique) et sont susceptibles d'avoir le même résultat.


Voir la vidéo: Les enzymes de restriction Biochimie. Biologie Moléculaire (Août 2022).