Informations

Existe-t-il des protéines qui stabilisent l'ARNm:ARN polymérase ou le complexe ARNm:ribosome ?

Existe-t-il des protéines qui stabilisent l'ARNm:ARN polymérase ou le complexe ARNm:ribosome ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Les actinomycètes sont connus pour leur capacité à produire une riche variété de produits naturels, et en particulier des polycétides. De nombreux gènes qui codent pour les voies de biosynthèse sont assez gros, car ils pourraient atteindre 20 Ko. Ces bactéries ont très probablement une sorte de mécanisme qui assurerait une transcription et une traduction efficaces de ces longs ORF. Cela pourrait être fait de deux manières : soit en stabilisant le complexe ARNm:ARN polymérase, soit en stabilisant le complexe ARNm:ribosome. L'un d'entre vous a-t-il entendu parler de tels mécanismes chez les bactéries ?


J'ai cherché des informations sur ce sujet car j'avais l'habitude de travailler dans le domaine de la biosynthèse des protéines, mais sans succès. Cependant, un argument contre la tendance des ribosomes à tomber de l'ARNm est le mécanisme très spécifique de libération des ribosomes après que le codon d'arrêt a été atteint (décrit ici).

Il existe d'autres problèmes possibles avec les ARNm très longs :

  • Dégradation possible de l'ARNm (procaryote) pendant un long temps de traduction. J'imagine que l'ARNm devrait contenir des caractéristiques structurelles qui prolongent sa durée de vie.
  • Mauvais repliement et précipitation possibles du produit protéique avant que la protéine entière ne soit terminée. Je pense qu'il existe probablement des protéines chaperons qui protègent les régions hydrophobes ou encouragent le repliement des domaines pour empêcher cela.

En note de bas de page, on pense que l'ARNm le plus long est celui de la protéine musculaire, la titine. L'assemblage de celui-ci sur le sarcomère ne serait pas typique des polykétides, par exemple, mais d'autres problèmes rencontrés pourraient être similaires.


Il existe en effet un gène, appelé nusG, qui serait antiterminateur de la transcription de l'ARN. NusG se lie à l'ARN polymérase, ce qui entraîne une augmentation du taux d'allongement de l'ARN, une diminution du temps pendant lequel la polymérase se trouve dans des états de pause de courte durée et la suppression des états de pause stabilisés de longue durée 1.

NusG s'est avéré important pour la découverte et la biosynthèse de produits naturels :

La surexpression de nusG dans C. cellulolyticum a permis l'isolement de sept nouveaux analogues du closthioamide, nommés closthioamides B-H86. Ces nouveaux composés sont des dérivés tronqués et partiellement substitués en O du composé hexathioamide parent antibactérien, mais ont une activité antibactérienne nettement inférieure 2

De plus, le gène de type nusG se trouve dans le groupe de gènes Myxococcus xanthus codant pour l'antibiotique myxovirescine (TA). L'un des gènes codant pour les polycétides de ce groupe mesure environ 27 ko [3] :

  1. Herbert, K.M. et al. E. coli NusG inhibe le retour en arrière et accélère la transcription sans pause en favorisant la translocation vers l'avant de l'ARN polymérase. J. Mol. Biol. 399, 17-30 (2010)

  2. Peter J. Rutledge & Gregory L. Challis. Découverte de produits naturels microbiens par activation de clusters de gènes biosynthétiques silencieux. Nature Reviews Microbiologie 13, 509-523 (2015)

  3. http://mibig. Secondarymetabolites.org/repository/BGC0001025/index.html#cluster-1


Relevé de notes principal

UNE relevé de notes principal est le produit d'acide ribonucléique (ARN) monocaténaire synthétisé par transcription de l'ADN et traité pour donner divers produits d'ARN matures tels que les ARNm, les ARNt et les ARNr. Les transcrits primaires désignés comme étant des ARNm sont modifiés en vue de la traduction. Par exemple, un ARNm précurseur (pré-ARNm) est un type de transcrit primaire qui devient un ARN messager (ARNm) après traitement.

Le pré-ARNm est synthétisé à partir d'une matrice d'ADN dans le noyau cellulaire par transcription. Le pré-ARNm comprend la majeure partie de ARN nucléaire hétérogène (hnARN). Une fois que le pré-ARNm a été complètement traité, il est appelé « ARN messager mature », ou simplement « ARN messager ». Le terme hnRNA est souvent utilisé comme synonyme de pré-ARNm, bien que, au sens strict, le hnRNA puisse inclure des transcrits d'ARN nucléaires qui ne se transforment pas en ARNm cytoplasmique.

Plusieurs étapes contribuent à la production de transcrits primaires. Toutes ces étapes impliquent une série d'interactions pour initier et compléter la transcription de l'ADN dans le noyau des eucaryotes. Certains facteurs jouent un rôle clé dans l'activation et l'inhibition de la transcription, où ils régulent la production de transcrits primaires. La transcription produit des transcrits primaires qui sont encore modifiés par plusieurs processus. Ces procédés comprennent la coiffe 5', la 3'-polyadénylation et l'épissage alternatif. En particulier, l'épissage alternatif contribue directement à la diversité des ARNm présents dans les cellules. Les modifications des transcrits primaires ont été étudiées plus avant dans le cadre de recherches visant à mieux connaître le rôle et la signification de ces transcrits. Des études expérimentales basées sur les modifications moléculaires des transcrits primaires et les processus avant et après la transcription ont conduit à une meilleure compréhension des maladies impliquant des transcrits primaires.


L'extension de l'espacement entre la séquence Shine-Dalgarno et le codon P-Site réduit le taux de translocation d'ARNm

Les séquences d'ARNm Shine–Dalgarno (SD) régulent l'allongement de la traduction.

L'extension de l'espaceur entre la séquence SD et le codon du site P déstabilise les interactions ARNm-ARNt-ribosome.

L'extension de l'espaceur entre la séquence SD et le codon du site P inhibe la translocation de l'ARNm.

En formant des interactions d'appariement de bases avec l'extrémité 3' de l'ARNr 16S, les séquences d'ARNm Shine-Dalgarno (SD) positionnées en amont des cadres de lecture ouverts facilitent l'initiation de la traduction. Pendant la phase d'élongation de la synthèse des protéines, les séquences intragéniques de type SD stimulent le décalage du cadre de lecture du ribosome et peuvent également ralentir le mouvement du ribosome le long de l'ARNm. Ici, nous montrons que la longueur de l'espaceur entre la séquence SD et le codon du site P affecte fortement le taux de translocation des ribosomes. L'augmentation de la longueur de l'espaceur au-delà de 6 nt déstabilise les interactions ARNm-ARNt-ribosome et entraîne une réduction de 5 à 10 fois du taux de translocation. Ces observations suggèrent que pendant la traduction, l'espaceur entre la séquence SD et le codon du site P subit des réarrangements structurels, qui ralentissent la translocation de l'ARNm et favorisent le décalage du cadre de l'ARNm.


RÉSULTATS

L'homologie de PTB1 et PTB2 avec la PTB de mammifère

Contrôle de la T. brucei génome a révélé plusieurs protéines qui pourraient potentiellement participer à la régulation de trans-épissage (Liang et al. 2003). Deux protéines précédemment identifiées, DRBD3 et DRBD4, présentent des similitudes avec la PTB des mammifères (De Gaudenzi et al. 2005). Sur la base de cette homologie, nous avons renommé DRBD3 en PTB1. Cette protéine est annotée dans GeneDB en tant que Tb09.211.0560. Nous avons renommé DRBD4 en PTB2, qui est annoté Tb11.01.5690. Pour démontrer davantage que ces protéines sont en fait T. brucei homologues PTB, nous avons comparé la structure de T. brucei protéines aux protéines PTB humaines ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1 et nPTB <"type ":"entrez-protein","attrs":<"text":"NP_067013.1","term_id":"10863997">> NP_067013.1). Une comparaison schématique de leur structure de domaine putative est donnée sur la figure 1A, et l'identité et la similitude des domaines RRM des protéines humaines avec PTB1 ou PTB2 sont montrées sur la figure 1B. Les positions des domaines RRM dans les protéines sont indiquées dans les cases, et des flèches relient les résidus qui sont liés dans chaque domaine. Les données présentées dans la figure 1 suggèrent que le RRM 1 et le RRM 2 de T. brucei PTB1 sont principalement liés aux RRM correspondants des protéines humaines PTB et nPTB RRM1, RRM 2 et RRM 3 de T brucei PTB2 ressemble le plus étroitement à RRM1, RRM3 et RRM4 des protéines humaines PTB et nPTB. T. brucei PTB2 ne contient pas l'homologue RRM2 humain. Il existe un domaine RRM résiduel aux positions 98 & 02013163 de la protéine qui ressemble le plus à RRM 2 de la protéine humaine. En effet, la base de données de domaines (basée sur les programmes SMART, FPAM, PROSITE et INTERPROSCAN) n'a pas pu détecter un domaine homologue RRM2. Ce n'est que lorsque nous avons utilisé le programme SMART, avec la séquence d'acides aminés 98�, que ce domaine a été identifié comme un domaine RRM, bien qu'avec un score relativement faible. Nous avons appelé ce domaine divergent RRM X.

Représentation schématique de la comparaison entre la PTB humaine (PTB1 et nPTB) et la Tb PTB (PTB1 et PTB2). La séquence d'acides aminés des protéines mammifères PTB1 ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1) et nPTB ( <"type":"entrez-protein","attrs":<"text":"NP_067013.1","term_id":"10863997">> NP_067013.1) ont été comparés au trypanosome PTB1 (Tb09.211.0560 ) et PTB2 (Tb11.01.5690) en utilisant le programme pBLAST (Altschul et al. 1997) et Psi BLAST (Altschul et al. 1997). Pour examiner la relation entre chacun des domaines RRM des protéines de mammifères et les séquences de trypanosomes correspondantes, les programmes SMART, FPAM, PROSITE et INTERPROSCAN ont été utilisés. La position des domaines RRM des mammifères était basée sur les données de Wagner et Garcia-Blanco (2001). (UNE) Comparaison entre les domaines RRM. Chaque domaine RRM est encadré. Les acides aminés qui sont liés entre les protéines PTB sont connectés avec des flèches, et les positions exactes sont données à l'extérieur de la boîte. (B) La parenté (identité et similarité) entre les domaines RRM est indiquée entre les protéines PTB spécifiées dans UNE.

Nous avons ensuite recherché le génome entier ainsi que la liste de toutes les protéines contenant des RRM dans T. brucei (De Gaudenzi et al. 2005) avec les isoformes humaines de la PTB (indiquées sur la figure 1). Les deux protéines qui figuraient en tête de liste étaient PTB2 (7e �) et PTB1 (3e � ).

Silençage par ARNi de PTB1 et PTB2 démontre que ces deux facteurs sont essentiels à la croissance

Examiner le rôle des protéines PTB dans le métabolisme de l'ARN des trypanosomes, et en particulier déterminer si ces facteurs participent à trans- et cis-épissage, l'expression de ces gènes a été réduite au silence par l'ARNi. PTB1 et PTB2 ont été amplifiés à partir du génome, et des constructions de tige&# x02013loop ont été conçues. Les constructions étaient composées d'une tige de 479 paires de bases (pb) pour PTB1 et une tige de 443 pb pour PTB2, et tous deux portaient un bourrage dérivé de Pex séquences (Wang et al. 2000). Ces constructions ont été clonées en aval d'un promoteur EP régulé par la tétracycline et utilisées pour transfecter T. brucei (29-13) exprimant le répresseur tétracycline et la polymérase T7 (Wang et al. 2000). Les cellules clonées exprimant les constructions ont été sélectionnées sur phléomycine. La figure 2A montre la croissance de la PTB1 et PTB2 cellules silencieuses, démontrant une réduction marquée de la croissance cellulaire lors de l'extinction de chacun de ces facteurs. Bien que la croissance des deux PTB1 et PTB2 les cellules silencieuses ont été inhibées, PTB2 les cellules silencieuses ont été plus sévèrement affectées. La différence peut résulter de l'effet sur le traitement ou la stabilité de différents sous-ensembles d'ARNm par ces deux facteurs (voir ci-dessous). La réduction des ARNm et des protéines correspondantes dans les cellules silencieuses est présentée sur les figures 2, B et C. Les résultats indiquent une induction de la production d'ARNdb et une réduction de 80 % à 100 % du niveau des ARNm correspondants.

(UNE) PTB1 et PTB2 sont des gènes essentiels. La croissance des cellules non induites (−Tet) a été comparée aux cellules induites pour la production d'ARNdb (+Tet). Le nombre de cellules dans les cultures non induites est désigné par des losanges noirs le nombre dans les cultures induites, par des carrés gris. (B) Analyse nordique de PTB1 et PTB2 lors de l'extinction de l'ARNi. L'ARN a été préparé à partir de cellules non induites et de cellules après 3 jours d'induction. L'ARN total (20 &# 003bcg) a été séparé sur un gel de formaldéhyde à 1,2 % d'agarose &# x020132,2 M. L'ARN a été transféré et hybridé avec une sonde marquée au hasard spécifique des deux gènes. Le niveau d'ARN 7SL (contrôle pour une charge égale) a été détecté par hybridation avec l'oligonucléotide d'ARN 7SL anti-sens. L'identité des transcriptions est indiquée. (C) Analyse occidentale des protéines PTB (la gauche). L'extrait de cellules entières (30 &# 003bcg) a été séparé sur 12% de SDS &# x02013polyacrylamide et soumis à une analyse Western en utilisant des anticorps anti-PTB (dilué 1:10 000). Les marqueurs de masse moléculaire sont indiqués. Analyse occidentale du niveau de protéines PTB lors de l'extinction (droit). Les extraits protéiques totaux de 2 × 10 8 cellules provenant de cellules non induites et réduites au silence 3 jours après l'induction ont été séparés sur des gels de polyacrylamide SDS à 12% et soumis à une analyse Western à l'aide d'anticorps anti-PTB1 et anti-PTB2 (dilué à 1:10 000). Le niveau de hnRNP D0 a été utilisé comme contrôle pour une charge égale.

Des anticorps ont été produits contre PTB1 et PTB2, comme décrit dans Matériels et méthodes, et utilisés pour examiner la réduction du niveau de protéines lors de l'extinction. La spécificité des anticorps a été examinée en utilisant T. brucei des extraits de cellules entières et les résultats de la figure 2C (panneau de gauche) montrent que chaque anticorps ne reconnaît qu'un seul polypeptide. Lors du silence, une élimination complète de la protéine correspondante a été observée (figure 2C, panneau de droite). Ces résultats suggèrent que le silence de PTB1 et PTB2 était très efficace et que ces facteurs sont essentiels à la vie.

Localisation cellulaire et fractionnement biochimique de PTB1 et PTB2

La localisation des protéines de la PTB a été déterminée en fusionnant la PTB1 à la GFP, ou par immunofluorescence, en utilisant des anticorps contre la PTB2. Les résultats (Fig. 3A) montrent des images de l'ensemble du parasite (exposition longue) et une exposition courte du noyau (coin gauche). Les données suggèrent que les deux protéines sont localisées principalement dans le noyau des “peckles,”, mais une faible coloration a également été observée dans le cytoplasme.

(UNE) Localisation de PTB1 et PTB2 dans la cellule. (Supérieur panel) Imagerie des cellules exprimant la construction GFP-PTB1. Les cellules ont été fixées dans du formaldéhyde à 4 % (panneau une) fluorescence de PTB1-GFP (panneau b) noyaux colorés au DAPI (c) Fusion DIC de panneaux une et b. Les images ont été obtenues après une longue exposition. L'agrandissement de la zone nucléaire est cadré et a été obtenu en utilisant une exposition plus courte. (Inférieur panel) Immunofluorescence de PTB2. Les cellules ont été fixées avec du paraformaldéhyde à 2 % pendant 25 min, incubées avec des anticorps comme décrit dans Matériels et méthodes, et détectées par un anticorps secondaire conjugué au FITC. (Panneau une) Fluorescence de la protéine PTB2 (panneau b) noyaux colorés au DAPI (panneau c) Fusion DIC de panneaux une et b. Les images ont été obtenues après une longue exposition. L'agrandissement de la zone nucléaire est cadré et a été obtenu en utilisant une exposition plus courte. (B) Fractionnement d'extraits par FPLC pour déterminer la taille des complexes associés aux protéines PTB. Des extraits de cellules entières ont été préparés à partir de cellules parentales ou de cellules exprimant la protéine Prp31 marquée par BB2 (Liang et al. 2006). La préparation de l'extrait et la chromatographie sur colonne sont décrites dans Matériels et méthodes. Les protéines ont été soumises à une analyse occidentale en utilisant les anticorps pertinents (anti-BB2, anti PTB [cette étude], anti-U2AF65 [aimablement fourni par le Dr Mariano Levin, Institute for Genetic Engineering and Molecular Biology (INGEBI) et National Council of Science and Recherche technologique (CONICET)]). L'identité des protéines examinées est indiquée. Les positions d'élution des protéines marqueurs, BSA (66 kDa) et β-amylase (200 kDa), sont indiquées. (C) Coimmunoprécipitation des protéines PTB. L'extrait a été préparé à partir de 5 × 10 9 cellules, et l'immunoprécipitation a été réalisée avec les anticorps comme décrit dans Matériels et méthodes. Les échantillons ont été soumis à une analyse Western en utilisant des anticorps PTB1 et PTB2. Les protéines immunoprécipitées avec PTB1 ont été sondées avec anti-PTB2 et vice versa. L'extrait cellulaire total et le surnageant (5 %) ont été analysés avec des billes entières.

Nous avons ensuite examiné la distribution des facteurs en fractionnant des extraits dérivés de T. brucei au stade procyclique ou des extraits de cellules portant une protéine PRP31 marquée BB2 exprimée à partir de son site authentique (Liang et al. 2006). Les extraits ont été préparés dans des conditions à faible teneur en sel (KCl 50 mM) et fractionnés sur une colonne Superdex S-200 FPLC. Les fractions maximales de ces facteurs étaient différentes (Fig. 3B) PTB1 a été trouvé principalement dans les fractions 22�, tandis que PTB2 a été trouvé dans les fractions 24�. En raison de leur distribution différentielle, ces facteurs n'interagissent très probablement pas les uns avec les autres. Pour vérifier que c'est bien le cas, des anticorps dirigés contre chacune de ces protéines ont été utilisés dans des expériences d'immunoprécipitation. Les résultats de la figure 3C démontrent que les anticorps dirigés contre PTB1 ont immunoprécipité PTB1 mais pas PTB2, tandis que les anticorps dirigés contre PTB2 ont précipité PTB2 mais pas PTB1. Fait intéressant, PTB1 et PTB2 ne se fractionnent pas non plus avec plusieurs des facteurs d'épissage généraux tels que PRP31 ou U2AF65. Néanmoins, la taille des complexes portant PTB1 ou PTB2 est de l'ordre de 66�-kDa, suggérant que ces facteurs sont probablement associés à d'autres facteurs d'épissage ou protéiques. Néanmoins, les complexes formés avec PTB1 et avec PTB2 sont significativement plus petits que ceux associés à PRP31 et U2AF65.

PTB1 et PTB2 ne sont pas des facteurs d'épissage basal bien que leur silençage affecte le niveau à l'état d'équilibre de l'ARN SL et sa transcription naissante

Nous avons déjà démontré que le silence des facteurs d'épissage basal qui affectent le trans-l'épissage de tous les ARNm entraîne une élévation des niveaux d'ARN SL, car il n'est pas utilisé dans l'épissage et s'accumule donc dans la cellule (Mandelboim et al. 2003 Liu et al. 2004 Liang et al. 2006 Tkacz et al. 2007). Pour examiner si les protéines PTB1 et PTB2 sont des facteurs d'épissage basal, l'effet sur le niveau à l'état d'équilibre de l'ARN SL a été examiné par extension d'amorce après l'extinction de PTB. Les résultats présentés dans la figure 4A suggèrent que le silence des deux facteurs a réduit le niveau à l'état d'équilibre de l'ARN SL de 30 % et 60 % dans PTB1 et PTB2 cellules silencieuses, respectivement. Aucun effet sur le coiffage de l'ARN SL n'a été observé, puisque les arrêts décalés sur les nucléotides cap-4 étaient les mêmes dans les cellules non induites et dans les cellules appauvries en PTB1 ou PTB2. Pour examiner si trans-l'épissage est affecté au même degré que la réduction de l'ARN SL ou de manière plus drastique, le niveau de l'intermédiaire de structure Y a été examiné à l'aide d'un oligonucléotide complémentaire de la partie intron de l'ARN SL. Si trans-l'épissage est affecté à la première étape de l'épissage, le niveau de la structure Y est diminué, mais si la réaction est affectée à la deuxième étape, la structure Y s'accumule. Les résultats, illustrés à la figure 4B, suggèrent que la réduction des niveaux de l'intermédiaire de structure Y (39 % et 58 %, pour PTB1 et PTB2, respectivement) reflète la réduction du niveau d'ARN SL à l'état d'équilibre, suggérant que ni PTB1 ni PTB2 affecte le trans-épissage de tous les ARNm la réduction du niveau de la structure Y est bien corrélée avec la réduction du niveau d'ARN SL dans les cellules silencieuses. Des expériences mesurant l'étendue de la réduction de l'ARN SL et de l'intermédiaire de structure Y ont été répétées trois fois, et les résultats de ces expériences sont présentés sur la figure 4C. À ce stade, nous ne pouvons exclure la possibilité que ces facteurs puissent affecter le trans-épissage de seulement un sous-ensemble d'ARNm, mais les données suggèrent que ni PTB1 ni PTB2 ne sont un facteur d'épissage général qui affecte le niveau de la structure Y intermédiaire. Les défauts dus au silençage de PTB2 sont plus sévères que ceux observés pour PTB1. Ces différences ne peuvent pas être attribuées à des degrés différents de silençage, car dans les deux cas, le silençage a entraîné l'élimination complète des protéines.

Les niveaux d'ARN SL et de structure Y intermédiaires PTB1 et PTB2 silence. (UNE) Le niveau d'ARN SL. L'ARN total a été préparé à partir de cellules portant les constructions PTB avant induction (−Tet) et après 3 jours d'induction (+Tet). L'extension de l'amorce a été réalisée sur 10 x003bcg d'ARN avec un oligonucléotide radiomarqué complémentaire à l'extrémité 3&# de l'ARN SL (20708 répertorié dans le tableau supplémentaire S-1). L'ADNc a été séparé sur un gel de séquençage à 6 %. La position des butées résultant des différents cap nt est indiquée sur le la gauche. L'extension d'amorce avec U3 a été utilisée pour contrôler la quantité d'ARN dans l'échantillon. (B) Extension d'amorce pour déterminer le niveau de structure Y intermédiaire. Le même que dans UNE mais l'amorce 9091 a été utilisée (répertoriée dans S-1). (C) Analyse quantitative de l'ARN SL et de la structure Y intermédiaire lors PTB silence. Le niveau de l'ARN SL et de la structure Y dans les cellules non induites est indiqué dans les barres grises, et les mêmes valeurs dérivées de trois expériences de silençage indépendantes sont indiquées dans les barres blanches, l'écart type est indiqué.

Nous avons ensuite examiné si la réduction du niveau d'ARN SL pendant l'extinction résulte de l'arrêt de la transcription de l'ARN SL. A cette fin, un système de cellules perméables a été utilisé (Tschudi et Ullu 1990 Ullu et Tschudi 1990). L'ARN SL est le transcrit radiomarqué majeur dans ce système. Les résultats de la figure 5 indiquent des réductions de 54 % et 79 % du niveau d'ARN SL nouvellement transcrit à la suite de PTB1 et PTB2 silence, respectivement.

Transcription naissante dans PTB1 cellules silencieuses et PTB2 cellules silencieuses. Des cellules perméables ont été préparées à partir du même nombre de cellules non induites et silencieuses par PTB le troisième jour de silençage, comme décrit dans les matériels et méthodes. L'ARN marqué a été fractionné sur un gel dénaturant à 6 %. Les identités des ARN sont indiquées. Une exposition plus courte de l'ARN SL est indiquée sur le droit.

L'effet des protéines PTB sur le niveau d'ARN SL peut résulter soit d'un effet direct, soit d'un effet indirect. Par exemple, les protéines PTB peuvent interagir avec le promoteur ou avec le complexe de transcription d'ARN SL. Les protéines PTB peuvent également se lier à l'ARN SL naissant avant son assemblage avec les protéines Sm et ainsi affecter la stabilité de l'ARN SL naissant. Alternativement, l'effet sur la transcription de l'ARN SL pourrait être un effet indirect et l'une des protéines essentielles à la transcription de l'ARN SL peut être codée par un ARN de courte durée dont le niveau est régulé (réduit) dans les cellules silencieuses de la PTB.

Pour détecter une éventuelle liaison directe de la PTB au promoteur d'ARN SL, un test ChiP a été réalisé en utilisant des anticorps contre les protéines de la PTB. Les résultats (données non présentées) suggèrent que la PTB ne s'associe pas directement à l'ADN du promoteur SL. Nous avons ensuite examiné si la réduction du niveau d'ARN SL naissant pouvait être le résultat de la liaison de ces protéines à l'ARN SL naissant, par réticulation UV in vitro de la protéine PTB1 à l'ARN SL synthétisé dans des cellules perméables. Les résultats (données non présentées) suggèrent qu'aucune réticulation de ce type ne peut être observée lorsque des extraits de cellules entières ont été utilisés. Ces résultats suggèrent que l'effet de la PTB sur les niveaux d'ARN SL n'est probablement pas primaire et peut résulter d'une régulation négative d'un facteur encore non identifié qui fonctionne soit dans la transcription de l'ARN SL, soit dans la stabilisation de l'ARN SL naissant.

L'analyse par microarray de l'ARN isolé des cellules PTB1 et PTB2 silencieuses suggère des effets différentiels sur le transcriptome

Étant donné que les résultats présentés à la figure 4 suggèrent que ni PTB1 ni PTB2 n'est un facteur d'épissage général qui affecte l'épissage de tous les ARNm, nous avons cherché à identifier quels ARNm sont spécifiquement et différemment affectés dans les cellules appauvries pour PTB1 ou PTB2. L'ARN a été préparé à partir de cellules après 3 jours de silençage et a été comparé à l'ARN de cellules non induites.

Trois répétitions biologiques ont été réalisées et hybridées à T. brucei microarrays décrits dans Matériels et méthodes. Les données ont été analysées à l'aide du logiciel GeneSpring GX (Agilent Technologies). Une normalisation inférieure a été effectuée pour corriger le biais de colorant, et les données normalisées ont été utilisées pour identifier les gènes dont l'expression semblait être significative (P valeur π.05) régulée à la hausse ou à la baisse, avec une coupure arbitraire d'au moins 1,5 fois. Une liste de ces gènes est fournie dans le tableau supplémentaire S-2. Afin de visualiser les différences d'expression des gènes dans le PTB cellules silencieuses, un regroupement hiérarchique de liaison moyen a été effectué sur les gènes sélectionnés en utilisant la corrélation de Pearson comme mesure de similarité, et une carte thermique a été construite représentant la différence de niveau de transcrits entre les cellules non induites et silencieuses (Fig. 6). Les résultats démontrent que PTB1 et PTB2 affectent différemment le transcriptome, suggérant que ces protéines se lient à différents sous-ensembles d'ARNm.

Carte thermique des gènes qui sont exprimés de manière différentielle entre les cellules silencieuses PTB1 et PTB2 par rapport aux cellules non induites. Transcriptions qui diffèrent du contrôle par ϡ,5 fois le changement (P valeur π.05) ont été choisis pour l'analyse. Chaque colonne représente la moyenne de trois répétitions biologiques. La carte thermique a été générée à l'aide du logiciel Genspring GX (technologies Agilent) en utilisant l'algorithme de regroupement hiérarchique de liaison moyenne et la corrélation de Pearson comme mesure de similarité. Le diagramme représente le niveau d'expression différentiel selon l'échelle de couleurs suivante : rouge, gènes régulés à la hausse bleus, gènes régulés à la baisse.

Étant donné que PTB1 et PTB2 affectent non seulement l'épissage mais également la stabilité de l'ARNm (voir ci-dessous), la liste des gènes régulés a été examinée pour la présence de séquences riches en faisceaux polypyrimidiques dans les séquences flanquant la séquence codante aux extrémités 5 & 3 & 02032 de l'ORF. À cette fin, des séquences de 300 pb en amont et de 500 pb en aval de chaque gène ont été extraites de GeneDB à l'aide de l'outil de téléchargement “list” (http://www.genedb.org). La recherche a été effectuée à l'aide d'un programme en langage C écrit en interne (disponible auprès des auteurs sur demande).

Le programme a été conçu pour rechercher trois types de séquences : (1) des séquences portant un faisceau polypyrimidique optimal (en tant que signal d'épissage), défini comme un tronçon d'au moins dix T avec un seul C autorisé (Benz et al. 2005) ( 2) les voies polypyrimidiques qui portent des segments de T et C, où T est plus abondant, et contiennent également des sites de liaison PTB (TCTT et/ou TCTCT) et (3) des voies polypyrimidiques non optimales (en tant que signaux d'épissage) qui manquent de séquences PTB, et dans laquelle T comprend au moins 59 % de la séquence (Benz et al. 2005). Cent soixante-dix gènes ont été régulés à la baisse et 146 gènes ont été régulés à la hausse par plus de 1,5 fois dans les cellules PTB1 silencieuses par rapport au contrôle. Parmi ceux-ci, 49 des gènes régulés à la baisse et 36 des gènes régulés à la hausse portent un site non conventionnel de polypyrimidine (PPT) contenant un site de liaison PTB dans leur région amont, et sont présentés dans le tableau supplémentaire S-3. 150 gènes ont été régulés à la baisse et 214 gènes ont été régulés à la hausse par plus de 1,5 fois dans les cellules silencieuses PTB2 par rapport au contrôle. Parmi ces gènes, 46 des gènes régulés à la baisse et 51 des gènes régulés à la hausse n'ont pas de site PPT canonique, contenant des séquences de liaison PTB dans leur région amont, et sont présentés dans le tableau supplémentaire S-4. Les gènes répertoriés dans les tableaux supplémentaires S-3 et S-4 sont très probablement des gènes qui sont régulés au niveau de l'épissage, tandis que les transcrits restants sont très probablement régulés au niveau de la stabilité de l'ARNm (voir ci-dessous). Pour examiner si des transcrits sont régulés à la fois par PTB1 et PTB2, un diagramme de Venn a été préparé. Les résultats n'indiquent aucun chevauchement significatif entre les transcrits régulés par les deux protéines PTB (données non présentées), suggérant que chaque facteur se lie à un sous-ensemble différent de transcrits. .

Validation des données de microarray

Pour valider les résultats obtenus par le microarray, plusieurs transcrits ont été sélectionnés dans la liste du tableau supplémentaire S-2 des substrats potentiels PTB1 et PTB2 qui sont soit régulés à la hausse, soit à la baisse. L'ADNc a été préparé à partir de l'ARN en utilisant des amorces aléatoires. La quantité d'ARN dans chaque échantillon a été calibrée en examinant le niveau de tubuline, un transcrit dont le niveau n'a pas été altéré dans les cellules silencieuses PTB. Les candidats ont été sélectionnés en fonction de leur changement de facteur au cours de l'extinction (plus de 2,3 fois), et seuls les ARNm abondants (basés sur l'intensité de l'hybridation dans les expériences de microarray) ont été analysés. Nous avons également préféré choisir des gènes qui ont une annotation claire dans le génome. Les résultats de la figure 7A résument la validation de cinq transcrits régulés à la hausse et de quatre transcrits régulés à la baisse dans PTB1 cellules silencieuses, et celles de la figure 7B résument quatre transcrits régulés à la hausse et cinq transcrits régulés à la baisse dans PTB2 cellules silencieuses. Ces résultats confirment que les données des puces à ADN reflètent en effet de véritables changements dans le transcriptome à la suite de l'extinction de la PTB, et que ces transcrits sont soit régulés à la baisse, soit régulés à la hausse en raison de PTB épuisement. Pour démontrer la spécificité de l'effet sur ces transcrits distincts, le niveau de substrats PTB1 a été examiné dans des cellules silencieuses PTB2 et vice versa. Les résultats indiquent que le silençage de chacune des protéines de la PTB a spécifiquement affecté un sous-ensemble unique de transcrits, confirmant à nouveau l'idée que ces facteurs agissent sur différents substrats.

Validation des données de microarray par RT-PCR. L'ADNc a été préparé à partir d'ARN total (1 μg) dérivé de cellules non induites (−Tet) ou de cellules après 3 jours de silençage (+Tet), comme décrit dans Matériels et méthodes. Une aliquote de l'ADNc (1/50 à 1/100) a été amplifiée par PCR en utilisant les amorces spécifiques du gène (énumérées dans le tableau supplémentaire S-1). La réaction PCR a été analysée sur des gels d'agarose à 1 % et visualisée par coloration au bromure d'éthidium. La quantité d'ADNc a été calibrée en mesurant la quantité de tubuline dans l'échantillon. Pour chaque réaction, nous avons déterminé la linéarité de l'amplification en diluant l'ADNc. Les gènes présentés sont ceux qui ont été significativement régulés à la hausse ou à la baisse lors de l'extinction (d'au moins 2,3 fois dans les données des puces à ADN). A titre de contrôle, le niveau de ces transcrits a été examiné dans des ARN extraits de cellules silencieuses pour l'autre PTB. (UNE) Gènes régulés à la hausse et à la baisse dans PTB1 cellules silencieuses (B) un péché UNE, mais pour PTB2 cellules silencieuses. Le numéro d'accession et l'annotation de chaque gène, basés sur GeneDB, sont présentés.

Ensuite, nous avons examiné si la régulation à la baisse ou à la hausse est un résultat direct de la liaison de ces facteurs aux ARNm apparentés. La liaison de PTB a été examinée par immunoprécipitation des transcrits en utilisant des anticorps contre PTB1 et PTB2. Pour stabiliser les interactions ARNm & protéines, les cellules ont été exposées à une irradiation UV, des extraits ont été préparés à partir des cellules et l'ARN immunoprécipité a été soumis à une RT-PCR pour détecter les transcrits pertinents. Comme contrôle, du sérum pré-immun a été utilisé. Les résultats présentés sur la figure 8 démontrent la liaison sélective de la PTB1 (figure 8A) et de la PTB2 (figure 8B) aux transcrits apparentés dont les niveaux ont changé pendant l'extinction. Parmi les gènes testés, trois se sont avérés faux positifs dans deux des trois (Tb927.4.5390 et Tb927.6.2640), leurs modifications au cours de la déplétion n'ont pas non plus été confirmées par RT-PCR. Pour vérifier la spécificité de la liaison, des substrats de PTB1 ont été examinés parmi les ARNm immunoprécipités par des anticorps anti-PTB2 et vice versa. Les résultats démontrent une spécificité complète, puisqu'aucun substrat PTB1 n'a été immunoprécipité en utilisant des anticorps anti-PTB2 et vice versa.

Identification des substrats PTB1 et PTB2 par immunoprécipitation avec des anticorps apparentés. L'extrait de cellules entières a été préparé à partir de 5 &# x000d7 10 9 cellules parentales après 5 min de réticulation UV comme décrit dans Matériels et méthodes. L'immunoprécipitation a été réalisée avec un sérum anti-PTB1, anti-PTB2 ou pré-immun témoin. L'ARN a été élué des billes et, avec l'ARN total (entrée), a été analysé par RT-PCR. Les amorces utilisées pour l'amplification des gènes spécifiques sont répertoriées dans le tableau supplémentaire S-1. Le numéro d'accession et l'annotation des gènes basés sur GenDB sont présentés. En tant que contrôle, les substrats de PTB2 ont été examinés dans les ARNm immunoprécipités de PTB1 et vice versa, ces transcrits de contrôle sont marqués d'astérisques.

Pour chaque transcrit, la modification du taux d'ARNm peut provenir d'un ou plusieurs mécanismes. La PTB peut affecter la transcription de l'ARNm, la stabilité de l'ARNm ou l'épissage du pré-ARNm. Une diminution du niveau du transcrit dans les cellules silencieuses peut suggérer que la PTB est essentielle pour la transcription, l'épissage ou la stabilisation du transcrit. Cependant, nous ne pouvons pas exclure la possibilité que le niveau de transcrits soit également affecté par des effets secondaires. Par exemple, l'une des cibles PTB peut en soi être une protéine de liaison à l'ARN qui affecte le niveau d'autres substrats. Cependant, aucune correspondance exacte avec les séquences présentes dans la construction de silençage n'existe dans le génome qui pourrait réduire au silence un gène autre que les gènes PTB et donc générer un effet hors cible.

Bien que la régulation transcriptionnelle (au niveau de l'initiation) ne semble pas jouer un rôle majeur dans la régulation des gènes chez les trypanosomes, PTB le silençage affectait la transcription de l'ARN SL. Il était donc intéressant d'examiner l'effet de PTB silençage sur la transcription de gènes codant pour des protéines, et la comparer à la transcription de gènes non codants transcrits par la polymérase I ou III. La PTB peut se lier à l'ADN et affecter l'allongement de la transcription. Pour examiner si PTB le silençage affecte la transcription, l'ARN naissant synthétisé dans des cellules perméables a été utilisé pour sonder des slot blots portant des produits de PCR de transcrits qui ont démontré des niveaux modifiés dans les cellules silencieuses de PTB. Les résultats ( Fig. 9 ) montrent que dans les deux PTB1 cellules silencieuses (Fig. 9A) et PTB2 cellules silencieuses (figure 9B), l'effet sur la transcription naissante des ARNm codant pour une protéine était très modeste par rapport à son effet sur la transcription de l'ARN SL. Notez qu'aucun changement dans la transcription n'a été observé pour les transcrits dont les niveaux ont été élevés pendant l'extinction (marqués par des flèches). Les résultats démontrent également que l'arrêt de la transcription est très probablement spécifique de la polymérase II, puisque l'effet le plus significatif a été observé pour les transcrits de la polymérase II, et aucun effet n'a été observé sur la transcription de l'ARNr (transcrit par la polymérase I) ou du snRNA U2, qui est transcrit dans les trypanosomes par la polymérase III (Nakaar et al. 1994). Cependant, nous ne pouvons pas exclure la possibilité que la PTB se lie à des séquences d'ADN particulières le long du génome et affecte l'allongement de la transcription de tels loci. Néanmoins, nous n'avons pas pu détecter de tels loci dans notre criblage limité pour les substrats PTB.

Synthèse naissante d'ARN dans PTB1 et PTB2 cellules silencieuses. Des cellules perméables ont été préparées à partir de cellules non induites (−Tet) et de cellules après 3 jours de silence PTB1 et PTB2 (+Tet) comme décrit dans Matériels et méthodes. L'ARN a été utilisé pour l'hybridation avec un slot blot contenant l'ADN codant pour les gènes, comme indiqué. (UNE) PTB1 (B) PTB2. L'identité des gènes est donnée par leur numéro d'accession. Comme contrôle, le gène SIRT de mammifère a été utilisé. Les gènes régulés à la hausse basés sur le tableau sont indiqués par des flèches.

PTB1 et PTB2 affectent la stabilité d'ensembles distincts d'ARNm

Chez les mammifères, il a été démontré que la PTB régissait la stabilité de l'ARNm en se liant à l'UTR 3′ (Soderberg et al. 2002 Kosinski et al. 2003 Tillmar et Welsh 2004). Pour examiner si PTB1 et PTB2 régulent de manière similaire la stabilité de leurs substrats, la demi-vie des transcrits cibles PTB1 et PTB2 a été examinée. Deux cibles PTB1 ont été sélectionnées : AATP11 (Tb927.4.4730), qui code pour un transporteur d'acides aminés dont l'expression est régulée à la baisse lors de l'extinction de la PTB, et un transcrit codant pour une protéine hypothétique, HP2690 (Tb11.01.2690), dont le niveau est régulé à la hausse. pendant le silence (Fig. 7A). Pour PTB2, les transcriptions suivantes ont été sélectionnées : AQP3 encodant une aquaporine de canal d'eau (Tb927.6.1520), qui est régulée à la baisse, et EDP (pyruvate déshydrogénase Tb10.389.0890) dont le niveau est régulé à la hausse dans PTB2-cellules silencieuses (Fig. 7B). Pour mesurer la demi-vie de l'ARNm pendant l'extinction, les cellules non induites et les cellules 3 jours après l'induction ont été concentrées. Après quelques minutes de récupération, les cellules ont été traitées avec de la sinefungine, qui s'est avérée inhiber trans-épissage et pour aider à arrêter la production d'ARNm, cet agent améliore donc la qualité des expériences qui déterminent la demi-vie des ARNm (Colasante et al. 2007). De la sinefungine a été ajoutée aux cellules pendant 10 min, puis de l'actinomycine D a été ajoutée et l'ARN a été extrait des cellules aux moments indiqués. L'analyse Northern a été effectuée en utilisant les sondes indiquées.Les mêmes membranes ont été hybridées avec une sonde spécifique de l'ARN 7SL. Le niveau des ARNm a été mesuré par densitométrie et la demi-vie a été calculée en se normalisant au niveau d'ARN 7SL. Comme le montre la figure 10A , la demi-vie de AATP11 L'ARNm a diminué de 43 à 22 min, tandis que la demi-vie de HP2690 a été augmenté de 10 à 100 min dans les cellules silencieuses PTB1. La demi-vie de AQP3 a été réduite de 80 min à 20 min, et celle de PDE a été augmentée de 40 min à 75 min dans les cellules silencieuses PTB2 (Fig. 10B). Les résultats de la figure 10 ont été répétés trois fois et chaque point dans le temps est représenté avec son écart type correspondant. Ces résultats suggèrent que les deux protéines PTB affectent la stabilité des ARNm en les stabilisant ou en les déstabilisant. Fait intéressant, le changement de pli dans AATP11 les niveaux dans les cellules silencieuses dépassent le changement observé dans la demi-vie de l'ARNm correspondant, ce qui suggère que la PTB peut exercer sa régulation sur ce transcrit via un ou plusieurs mécanismes supplémentaires (voir ci-dessous).

PTB1 et PTB2 régulent la demi-vie des ARNm. Analyse Northern des niveaux d'ARNm. Les cellules non induites et appauvries en PTB1 (3 jours après l'induction) ont été traitées avec de la sinefungine (2 μg/mL) et, après 10 min, avec de l'actinomycine D (30 μg/mL). L'ARN a été préparé aux moments indiqués au-dessus des pistes, séparé sur un gel d'agarose à 1,2 % et de formaldéhyde et soumis à une analyse de Northern avec les sondes spécifiques du gène indiquées. L'ARN 7SL a été utilisé pour contrôler une charge égale. (UNE) PTB1 (B) PTB2. Les signaux d'hybridation montrés dans le supérieur panel ont été mesurés par densitométrie. Les courbes de décroissance sont indiquées sous les taches, et la demi-vie est illustrée par les lignes brisées. La décroissance en l'absence d'induction (−Tet) est indiquée par des losanges noirs lors de l'induction (+Tet), par des carrés gris.

Ces résultats montrent que les transcrits sont affectés de manière différentielle, avec une amplitude de régulation allant d'une différence de 2 à 10 fois. Cependant, les protéines PTB1 et PTB2 devraient reconnaître un domaine PPT enrichi de sites de liaison PTB, ainsi les transcrits apparentés devraient contenir de tels sites, et un site de liaison consensus devrait exister. Pour rechercher de telles séquences, un alignement multiple a été effectué à l'aide de ClustalW (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_server.html). Une série de 41 transcrits portant des séquences PPT qui ont été affectées dans les cellules silencieuses PTB1 et 98 transcrits qui ont été affectés dans les cellules silencieuses PTB2 ont été choisis pour l'analyse. Étant donné que ces sites de liaison ont été facilement détectés au niveau de l'UTR 3′, seules les séquences 3′ UTR ont été utilisées pour générer l'ensemble de données. L'alignement des séquences est présenté dans le tableau supplémentaire S-5. Les séquences mises en évidence contiennent un ou deux sites de liaison PTB intégrés dans le PPT.

PTB1 et PTB2 sont essentiels pour trans-épissage de transcrits portant des voies polypyrimidiques riches en C

Comme indiqué ci-dessus, les transcrits tels que l'AATP11 ont été régulés à la baisse au-delà des effets qui pourraient être attribués à la stabilité de l'ARNm, suggérant que la PTB peut également opérer au niveau de l'épissage. Cette observation nous a conduit à inspecter le 5′ UTR des gènes qui ont été régulés à la baisse à la suite de PTB1 ou PTB2 silence. Nous avons identifié des transcrits qui n'ont pas de PPT consensus, ayant principalement des U, mais possédant des sites PTB riches en C. Six transcrits ont été choisis, et leur site d'épissage AG a été déterminé en amplifiant l'ARNm spécifique par RT-PCR avec une amorce anti-sens située à proximité de la première amorce sens AUG et SL. La séquence en amont du site d'épissage AG de six gènes est représentée sur la figure 11A, les PPT putatifs sont encadrés et en italique. L'inspection des séquences suggère que dans ces transcrits, la distance entre l'AG et le PPT est de 10� nucléotides (nt), ce qui dans la plupart des cas, est plus long que la moyenne de 25 nt précédemment observée (Benz et al. 2005). Le rapport U/C est de 1,52 contre 2 trouvé dans la majorité des transcrits (Benz et al. 2005). De plus, un site de liaison PTB a été trouvé incrusté dans chacun des sites PPT. Pour examiner si le trans-l'épissage de ces transcriptions est affecté sous PTB silençage, les niveaux de l'ARNm mature et pré-m ont été déterminés lors du silençage PTB par RT-PCR. Étant donné que U2AF65 se lie aux sites PPT (Zamore et al. 1992), il était intéressant de déterminer si le trans-l'épissage de ces transcrits riches en C PPT dépend également de la présence de U2AF65. Les T. brucei U2AF65 a été récemment décrit et est plus gros que son homologue mammifère. Il interagit avec SF1 mais pas avec U2AF35 et affecte la première étape du trans-réaction d'épissage (Vazquez et al. 2009). À cette fin, le trans-l'épissage des six transcriptions a été examiné en PTB1 cellules silencieuses, PTB2 cellules silencieuses, et U2AF65 cellules silencieuses. Les résultats (Fig. 11B) suggèrent que dans cinq des transcriptions, trans-l'épissage a été perturbé dans PTB1 cellules silencieuses ou PTB2 cellules silencieuses, suggérant que le trans-l'épissage de ces transcrits dépend de la présence de PTB1 ou PTB2. Pour contrôler la spécificité et la quantité d'ARN utilisée dans les réactions, nous avons utilisé l'ARNm de tubuline comme contrôle, car le niveau de ce transcrit ne change pas lors de l'extinction de PTB1 ou PTB2. Pour U2AF65, le niveau d'ARN 7SL a été utilisé pour la normalisation, puisque U2AF65 est un facteur d'épissage général qui affecte le trans-épissage de tous les gènes. Les résultats de la figure 11 suggèrent donc que les protéines PTB fonctionnent en plus, et non à la place, de U2AF65, puisque trans-l'épissage des mêmes six transcrits nécessitait la présence d'U2AF65 fonctionnel pour une bonne trans-épissage.

Analyse des gènes dont trans-l'épissage est régulé par les protéines PTB. (UNE) La séquence en amont du site d'épissage AG est indiquée, et les séquences de l'AG sont en gras et soulignées, la séquence PPT en italique et encadrée, et les sites de liaison PTB putatifs dans les séquences PPT sont en gras. Le numéro d'accession et la régulation par PTB1 ou PTB2 sont indiqués. (B) RT-PCR pour déterminer le niveau de pré-ARNm et d'ARNm mature sous PTB1, PTB2, et U2AF65 silence. L'ADNc a été préparé à partir de cellules non induites ou à partir de cellules après 3 jours de silençage. L'étalonnage de la quantité d'ADNc a été réalisé en utilisant le gène de la tubuline. La RT-PCR a été réalisée comme décrit dans Matériels et méthodes. Les amorces utilisées pour amplifier le pré-ARNm et l'ARN mature sont répertoriées dans le tableau supplémentaire S-1. Les produits de PCR ont été séparés sur des gels d'agarose à 1 % et colorés au bromure d'éthidium. Les numéros d'accession des gènes sont indiqués. Comme contrôle de la quantité d'ADNc dans chaque échantillon, la quantité de tubuline a été déterminée pour l'ARN de PTB1 et PTB2 cellules silencieuses et la quantité d'ARN 7SL dans l'ARN des cellules silencieuses U2AF65.

Comme chez les mammifères, la PTB est un répresseur d'épissage, nous avons recherché dans l'ensemble de données des gènes régulés à la hausse les gènes qui portent un site PPT riche en C. Une telle transcription (numéro 6 dans la liste, Tb11.01.3580) a été identifiée, et en effet, le silence de PTB1 amélioré son trans-épissage, suggérant que le PTB1 peut servir de répresseur ou d'activateur d'épissage. De nombreux autres transcrits de ce type peuvent exister parmi les transcrits qui ont des sites de liaison PTB dans leur PPT, et dont le niveau est régulé à la hausse pendant l'extinction.

Identification du AATP11 Sites de liaison PTB1 in vivo et in vitro

Pour vérifier que la PTB se lie aux sites de liaison putatifs indiqués sur la figure 11A, le AATP11 substrat a été utilisé pour une analyse plus approfondie. Des études récentes suggèrent que ce gène est fortement exprimé au stade procyclique du parasite et est régulé via la stabilité de l'ARNm, dictée par les séquences présentes dans le 3′ UTR du gène (Robles et Clayton 2008). La séquence de AATP11 et la position du PPT par rapport au site d'épissage AG sont présentées sur la figure 12A (EST <"type":"entrez-nucleotide","attrs":<"text":"AF009707","term_id":"2735809" >> AF009707). Un test de protection contre la RNase a été effectué pour examiner trans-défauts d'épissage de AATP11 dans PTB1 cellules silencieuses. Les résultats (Fig. 12B, panneau c) démontrent l'accumulation du précurseur et la réduction de la maturité AATP11 à la suite du silence PTB1.

Analyse in vivo et in vitro de AATP11, un gène dont l'épissage est régulé par PTB1. (UNE) Représentation schématique du AATP11 transcription. L'épissure AG et le PPT sont soulignés. Les substitutions de bases introduites dans le PPT sont indiquées par des flèches. (B) Protection RNase de AATP11 transcription. Représentation schématique des sondes utilisées pour la protection RNase des prématurés et matures AATP11 transcriptions. (Panneau une) La sonde utilisée pour protéger le transcrit de type sauvage de la taille attendue en nucléotides des fragments matures et précurseurs protégés sont indiqués. (Panneau b) Représentation schématique de la sonde utilisée pour protéger le AATP11 Unité régulatrice 5′ fusionnée au gène de la luciférase. Les tailles des fragments matures et protégés sont indiquées. (Panneau c) Fragments protégés du AATP11 transcrit de type sauvage. L'ARN a été soumis à une protection par RNase comme décrit dans Matériels et méthodes, et les produits ont été séparés sur un gel d'urée acrylamide à 6 % & X020137 M. Les fragments protégés des cellules non induites (−Tet) et des cellules après 3 jours d'induction (+Tet) de PTB1 sont présentés. P indique la sonde C, contrôle (aucun ARN n'a été ajouté au mélange de digestion RNase) et M, marqueur (digeste pBR322 MspI marqué aux extrémités). Les positions du précurseur et de l'AATP11 mature sont indiquées. (Panneau ) Protection RNase du transcrit fusionné AATP11-luciférase. L'ARN a été préparé à partir de parasites transgéniques exprimant le gène de la luciférase de l'unité régulatrice AATP11 5′ (pNS21b). L'expression a été contrôlée dans les cellules PTB1 après 3 jours d'extinction. Les fragments protégés ont été séparés sur un gel à 6 % d'acrylamide et d'urée M. Une exposition plus longue du fragment protégé est présentée et indiquée par des flèches. P indique la sonde C, contrôle (aucun ARN n'a été ajouté à l'essai de protection RNase). (Panneau e) Protection RNase sur le transcrit fusionné AATP11-luciférase portant une mutation PPT. Le même que dans mais l'ARN a été préparé à partir de cellules portant la mutation PPT. (C) Les protéines qui deviennent croisées avec le AATP11 transcrit et au transcrit portant des mutations dans le site PPT. (Droit panel) La réticulation a été réalisée comme décrit dans Matériels et méthodes, en utilisant des extraits de cellules entières en présence de quantités croissantes de transcrit AATP-11 concurrent non marqué, non radioactif. (voies 14) Des quantités croissantes d'AATP-11 de type sauvage non marqué (0, 50, 100, 200 ng, respectivement) (voies 58) des quantités croissantes d'AATP-11 non marqué et non radioactif portant la mutation PPT (0, 50, 100, 200 ng, respectivement) (voie 9) réticulation avec PTB1 recombinante. (La gauche) Analyse occidentale. Le matériel réticulé a été soumis à une analyse Western avec des anticorps anti-PTB1. (Voie 1) Cross-linking utilisant une protéine recombinante (50 ng) (voie 2) réticulation à l'aide d'extrait de cellules entières. La taille du marqueur protéique est indiquée.

Ensuite, les 5&x02032 séquences flanquantes de AATP11 ont été clonés dans le vecteur pNS21b (64 nt de 5′ UTR) avec 260 nt supplémentaires en amont du site d'épissage AG, qui transporte les signaux essentiels pour trans-épissage du gène. Le vecteur contient donc un gène de luciférase, dont l'expression dépend des séquences flanquantes 5′ de la AATP11 gène (figure 12B, panneau b). Le transcrit est exprimé à partir du promoteur EP fort (Siegel et al. 2005), et les séquences 3&x02032 UTR sont dérivées du gène EP. Étant donné que le transcrit fusionné n'a pas l'authentique 3′ UTR du gène AATP11, l'effet sur l'expression observé dans cette étude dépend uniquement de la liaison de la PTB au AATP11 Site PPT.

Vérifier que la séquence présente 10 nt en amont du site d'épissage AG et portant le site de liaison PTB est bien le site qui régit la régulation d'épissage de AATP11 par PTB1, les C de ce site ont été convertis en U, détruisant ainsi les sites de liaison de PTB. La structure de la construction est montrée sur la figure 12B, panneau b, et l'emplacement des mutations introduites dans le site PPT est montré sur la figure 12A. Parasites transgéniques porteurs du gène rapporteur ainsi que de la construction tige&# x02013loop pour faire taire PTB1 ont été générés. Le traitement de la AATP11 Le transcrit fusionné à la luciférase a été examiné par protection RNase. Les résultats présentés sur la figure 12B, d , démontrent que, comme le gène de type sauvage, le AATP11-l'épissage de la luciférase était dépendant de la PTB1, puisque dans les cellules silencieuses, une réduction de l'ARN mature et l'accumulation de précurseur ont été observées. Cependant, la régulation par PTB1 a été perdue dans les cellules portant le tractus PPT muté, puisque le AATP11 le transcrit n'a montré aucune dépendance vis-à-vis de PTB1 pour l'épissage (figure 12B, e). En fait, les niveaux d'ARNm n'étaient pas réduits mais légèrement élevés. Ces données suggèrent que les PPT portant le site de liaison PTB et riches en C sont bien les sites de liaison qui confèrent la régulation PTB1 sur AATP11.

Pour examiner la liaison directe du PTB au AATP11 substrat, le pré-ARNm a été incubé avec soit du PTB1 recombinant soit un extrait de cellules entières et exposé à une réticulation UV. Après digestion par la RNase, la radioactivité reste associée aux seules protéines qui étaient liées à l'ARN marqué. Les résultats d'une telle expérience sont présentés sur la figure 12C. L'une des protéines qui sont devenues réticulées à AATP11 est PTB1, car une protéine migrant avec le même poids moléculaire que la PTB1 recombinante a été identifiée lorsque le pré-ARNm a été réticulé avec des protéines présentes dans l'extrait de cellules entières. L'identification de la bande PTB1 dans l'extrait de cellules entières a été vérifiée par analyse Western (figure 12C, panneau de gauche). De plus, la réticulation avec cette protéine (marquée d'une flèche) était réduite lorsqu'elle n'était pas pré-étiquetée.AATP11 a été ajouté à la réaction (réduction à 24 % de liaison lors de l'ajout d'un excès molaire de 200 de l'ARN non marqué), mais pas lorsqu'il n'est pas marqué muté AATP11, dépourvu des sites PTB, a été utilisé pour la compétition (réduction à 85 % de liaison lors de l'ajout d'un excès molaire de 200 de l'ARN non marqué) (figure 12C). Ces résultats montrent clairement la liaison directe de la PTB au AATP11 substrat au site de liaison PTB1 proposé. Notez qu'une telle liaison à AATP11 a également été détecté lorsque des anticorps anti-PTB1 ont été utilisés pour immunoprécipiter des substrats de PTB (figure 8A).

PTB1 mais pas PTB2 est essentiel pour cis-épissage

Comme il a été démontré que la PTB affecte cis-épissage chez les mammifères et s'est avéré non seulement se lier au PPT en amont du site d'épissage 3′ mais aussi à la région du site d'épissage 5′, nous avons examiné si PTB est également essentiel pour cis-épissage. A cet effet, deux substrats connus qui subissent cis-l'épissage ont été examinés. Les résultats de la figure 13 démontrent par RT-PCR (en utilisant la tubuline pour contrôler la quantité d'ARN) que l'épissage des deux poly A polymérase (BOUILLIE) et l'hélicase à ARN DEAD/H dépendante de l'ATP (ADRH) ont été affectées dans les cellules silencieuses, puisque dans les deux gènes, une réduction de l'ARN mature a été observée, avec une nette accumulation du précurseur. L'inspection du PPT de ces gènes suggère que leurs sites sont conventionnels. La présence d'un site de liaison PTB a été observée soit à proximité du site d'épissage 5′, dans le cas de BOUILLIE, ou en plusieurs positions dans l'intron, dans le cas de ADRH (voir le tableau supplémentaire S-6). Fait intéressant, aucun effet sur cis-l'épissage a été observé dans les cellules silencieuses PTB2 (Fig. 13).

cis-épissage de poly A polymérase (BOUILLIE) et les hélicases à ARN DEAD/H dépendantes de l'ATP (ADRH) est régulé par PTB1 mais pas par PTB2. Niveaux de précurseur de PAP et d'ADRH et d'ARNm mature détectés par RT-PCR. L'ADNc a été préparé comme décrit dans Matériels et méthodes. L'ADNc a été utilisé pour l'analyse PCR avec les amorces répertoriées dans le tableau supplémentaire S-1. La représentation schématique des amorces utilisées dans la réaction et les produits de PCR attendus sont illustrés sur le la gauche. Les réactions PCR ont été analysées sur un gel d'agarose à 1%. (La gauche) Analyse des cellules silencieuses PTB1. ADNc de cellules non induites (−Tet) et ADNc de cellules silencieuses PTB1 3 jours après induction (+Tet). (Droit) Analyse des cellules silencieuses PTB2. ADNc de cellules non induites (−Tet) et ADNc de cellules silencieuses PTB2 3 jours après induction (+Tet). Le niveau de transcrit de tubuline a été utilisé pour contrôler la quantité d'ADNc dans chaque échantillon.


Dégradation

Différents ARNm au sein d'une même cellule ont des durées de vie (stabilités) distinctes. Dans les cellules bactériennes, les ARNm individuels peuvent survivre de quelques secondes à plus d'une heure. Cependant, la durée de vie moyenne est comprise entre 1 et 3 minutes, ce qui rend l'ARNm bactérien beaucoup moins stable que l'ARNm eucaryote. ⎤] Dans les cellules de mammifères, la durée de vie de l'ARNm varie de quelques minutes à plusieurs jours. ⎥] Plus la stabilité d'un ARNm est grande, plus il peut produire de protéines à partir de cet ARNm. La durée de vie limitée de l'ARNm permet à une cellule de modifier rapidement la synthèse des protéines en réponse à ses besoins changeants. Il existe de nombreux mécanismes qui conduisent à la destruction d'un ARNm, dont certains sont décrits ci-dessous.

Dégradation de l'ARNm procaryote

En général, chez les procaryotes, la durée de vie de l'ARNm est beaucoup plus courte que chez les eucaryotes. Les procaryotes dégradent les messages en utilisant une combinaison de ribonucléases, y compris des endonucléases, des exonucléases 3' et des exonucléases 5'. Dans certains cas, de petites molécules d'ARN (ARNs) de dizaines à centaines de nucléotides de long peuvent stimuler la dégradation d'ARNm spécifiques en appariant des bases avec des séquences complémentaires et en facilitant le clivage de la ribonucléase par la RNase III. Il a été récemment montré que les bactéries ont également une sorte de coiffe 5' constituée d'un triphosphate à l'extrémité 5'. L'élimination de deux des phosphates laisse un monophosphate 5', provoquant la destruction du message par l'exonucléase RNase J, qui dégrade 5' en 3'.

Renouvellement de l'ARNm eucaryote

À l'intérieur des cellules eucaryotes, il existe un équilibre entre les processus de traduction et de désintégration de l'ARNm.Les messages qui sont activement traduits sont liés par les ribosomes, les facteurs d'initiation eucaryotes eIF-4E et eIF-4G, et la protéine de liaison poly(A). eIF-4E et eIF-4G bloquent l'enzyme de décapsulation (DCP2), et la protéine de liaison poly(A) bloque le complexe d'exosomes, protégeant les extrémités du message. L'équilibre entre la traduction et la décroissance se reflète dans la taille et l'abondance des structures cytoplasmiques connues sous le nom de corps P. La queue poly(A) de l'ARNm est raccourcie par des exonucléases spécialisées qui ciblent des ARN messagers spécifiques par une combinaison de séquences cis-régulatrices sur l'ARN et les protéines de liaison à l'ARN agissant en trans. On pense que le retrait de la queue Poly(A) perturbe la structure circulaire du message et déstabilise le complexe de liaison du capuchon. Le message est alors soumis à une dégradation soit par le complexe d'exosomes, soit par le complexe de décapage. De cette façon, les messages inactifs sur le plan de la traduction peuvent être détruits rapidement, tandis que les messages actifs restent intacts. Le mécanisme par lequel la traduction s'arrête et le message est transmis aux complexes de désintégration n'est pas compris en détail.

Désintégration des éléments riches en AU

La présence d'éléments riches en AU dans certains ARNm de mammifères a tendance à déstabiliser ces transcrits par l'action de protéines cellulaires qui se lient à ces séquences et stimulent l'élimination de la queue poly(A). On pense que la perte de la queue poly (A) favorise la dégradation de l'ARNm en facilitant l'attaque à la fois par le complexe d'exosomes et le complexe de décapage. La dégradation rapide de l'ARNm via des éléments riches en AU est un mécanisme essentiel pour prévenir la surproduction de cytokines puissantes telles que le facteur de nécrose tumorale (TNF) et le facteur de stimulation des colonies de granulocytes et de macrophages (GM-CSF). Les éléments riches en AU régulent également la biosynthèse de facteurs de transcription proto-oncogènes tels que c-Jun et c-Fos. ⎫]

Carie médiée par un non-sens

Les messages eucaryotes sont soumis à une surveillance par la désintégration non-sens (NMD), qui vérifie la présence de codons d'arrêt prématurés (codons non-sens) dans le message. Ceux-ci peuvent survenir via un épissage incomplet, une recombinaison V(D)J dans le système immunitaire adaptatif, des mutations dans l'ADN, des erreurs de transcription, une analyse qui fuit par le ribosome provoquant un décalage de cadre et d'autres causes. La détection d'un codon d'arrêt prématuré déclenche la dégradation de l'ARNm par décapage 5', élimination de la queue poly(A) 3' ou clivage endonucléolytique. ⎬]

Petit ARN interférent (siRNA)

Chez les métazoaires, les petits ARN interférents (siARN) traités par Dicer sont incorporés dans un complexe connu sous le nom de complexe de silençage induit par l'ARN ou RISC. Ce complexe contient une endonucléase qui clive des messages parfaitement complémentaires auxquels le siRNA se lie. Les fragments d'ARNm résultants sont ensuite détruits par des exonucléases. L'ARNsi est couramment utilisé dans les laboratoires pour bloquer la fonction des gènes en culture cellulaire. On pense qu'il fait partie du système immunitaire inné en tant que défense contre les virus à ARN double brin. ⎭]

MicroARN (miARN)

Les microARN (miARN) sont de petits ARN qui sont généralement partiellement complémentaires aux séquences des ARN messagers des métazoaires. La liaison d'un miARN à un message peut réprimer la traduction de ce message et accélérer l'élimination de la queue poly(A), accélérant ainsi la dégradation de l'ARNm. Le mécanisme d'action des miARN fait l'objet de recherches actives. ⎯]

Autres mécanismes de désintégration

Il existe d'autres moyens par lesquels les messages peuvent être dégradés, notamment la désintégration non-stop et le silence par l'ARN interagissant avec Piwi (piARN), entre autres.


Matériaux et méthodes

Préparation d'extraits de cerveau de poulet et de fibroblastes

Un extrait cytoplasmique de cerveau a été préparé à partir d'embryons de poulet âgés de 12 jours. Les cerveaux entiers ont été prélevés et lavés trois fois avec du tampon A (20 mM Tris Cl, 3 mM MgCl2, 40 mM de KCl et 1 mM de DTT, 0,7 g/ml de leupeptine, 1 g/ml d'aprotinine, 0,7 g/ml de pepstantine et 1 mM de PMSF). 1 ml de tampon A a été ajouté par gramme de tissu humide, et le mélange a été homogénéisé dans un homogénéisateur en verre Téflon. Les homogénats ont été centrifugés pendant 10 min à 5000 g, et le surnageant a été centrifugé pendant 2 h à 28 000 tr/min dans un rotor Beckman SW-40.1. Le surnageant à grande vitesse a été soit utilisé immédiatement, soit stocké en aliquotes à -70°C. La concentration en protéines de l'extrait de cerveau était 10-20 g/μl. Pour préparer l'extrait de CEF, des fibroblastes ont été isolés à partir de tissu musculaire mammaire d'embryons de poulet âgés de 11 jours. Les cellules ont été cultivées jusqu'à environ 95 % de confluence (Kislauskis et al., 1994), puis grattées et lavées dans du tampon froid A et sédimentées par centrifugation (Ross et al., 1997). Les cellules ont été remises en suspension dans du tampon A et homogénéisées dans un homogénéisateur Dounce. Les homogénats ont été centrifugés comme décrit ci-dessus. La concentration en protéines de l'extrait préparé était de 5 à 10 g/μl.

Cultures neuronales

Des cultures primaires de neurones du cerveau antérieur de poussin ont été générées comme décrit précédemment (Zhang et al., 1999). En bref, les prosencéphales ont été disséqués à partir d'embryons de poulet de 8 jours, trypsinisés, dissociés et étalés sur des lamelles recouvertes de poly-l-lysine- (0,2 mg/ml, 16 h) et de laminine (0,02 mg/ml, 12 min) dans du MEM. avec 10 % de FBS pendant 2 h. Les cellules ont été inversées sur une monocouche d'astrocytes de poulet dans N2-milieu conditionné avec du sérum (0,2% FBS) et cultivé pendant 4 jours à 37°C dans 5% CO2.

Transcription d'ARN in vitro

Le pCZIP a été construit en insérant le code postal de 54 nucléotides de l'ARNm de -actine de poulet dans un vecteur pSP64-Poly(A) (Promega) aux sites Hind III et Ava I. Pour construire le plasmide pCZIPm, la paire d'oligos complémentaires suivante a été synthétisée, hybridée et insérée entre les sites Hind III et Ava I du vecteur pSP64 Poly(A) : Sens : 5' AGCTTACCGGACT-GTTACCATGTGTGTGTGTGCTGTGATGAAACAAAACCCATAAATGC 3' et antisens : ACTCAC 5' .

Pour les tests de décalage de mobilité sur gel, l'ARN marqué au [32P] a été généré par transcription in vitro dirigée par l'ARN polymérase SP6 à partir d'ADN pCZIP linéarisé par Ava I. L'ARN transcrit a été purifié sur gel à 6 %. Pour la purification par affinité d'ARN, des transcrits polyadénylés ont été synthétisés in vitro avec la polymérase SP6 (kit MEGAScript Ambion) à partir de constructions pCZIP linéarisées par EcoRI. Des traces de [32P]-CTP ont été ajoutées pour permettre la détection et la quantification de l'ARN transcrit. L'ARN transcrit contenait les 54 nts d'ARN pCZIP et une queue poly(A) de 30 nts.

Essai de décalage de mobilité sur gel et réticulation UV

En bref, 10 5 CPM de la sonde d'ARN marquée au [32 P] ont été incubés à température ambiante avec 5 l d'extrait de protéine de cerveau ou de fibroblaste pendant 20 min dans une solution de liaison de 20 l contenant 20 mM d'Hepes, pH 7,4, 50 mM de KCl , 3 mM de MgCl2, 2 mM de DTT et 5 % de glycérol. Les ARN non liés ont été dégradés par une incubation de 10 min avec 1 U de RNase T1, et les interactions ARN-protéine non spécifiques ont été minimisées par incubation avec 5 mg/ml d'héparine pendant 10 min. Les complexes ARN-protéine formés ont été séparés dans un gel natif à 4 % et visualisés par autoradiographie. Pour établir la spécificité des interactions ARN-protéine, des tests de compétition ont été effectués en pré-incubant l'extrait protéique avec des concurrents ARN non marqués.

La réticulation UV des complexes ARN-protéine a été réalisée en irradiant les réactions sur de la glace dans une chambre UV (GS gene linker Bio-Rad Laboratories) avec des ampoules UV de 254 nm, 8 W pendant 10 min et résolue par un gel natif à 4 %. Les complexes ARN-protéine réticulés aux UV, détectés par autoradiographie, ont été coupés du gel, mélangés avec du tampon de charge SDS et incubés avec 10 U de RNase T1 pendant 30 min à température ambiante. Les tranches de gel ont été chargées sur un gel SDS-polyacrylamide à 10 % et soumises à une électrophorèse pour distinguer les complexes ARN-protéine.

Purification par affinité des protéines qui se lient à l'ARN

2 ml de billes d'agarose poly(U) (type 6 Amersham Pharmacia Biotech) ont été mis en suspension dans un tampon de liaison à l'ARN (25 mM Tris HCl, pH 7,4, 100 mM KCl) et placés dans une colonne de 10 ml. Environ 1 mg d'ARN poly(A) zipcode synthétisé in vitro a été ajouté à la colonne et cyclé quatre fois. L'efficacité de l'ARN lié aux billes d'agarose poly(U) a été contrôlée en mesurant la quantité d'ARN marqué au [32P] présent dans la préparation d'ARN. Après liaison, les billes ont été équilibrées avec le tampon d'extrait, mélangées avec 40 ml d'extraits de protéines cérébrales ou 20 ml d'extraits de fibroblastes contenant 50 U/ml de RNasine (Promega), et incubées pendant 1 h à température ambiante sous agitation douce. Pour réduire la liaison aux protéines non spécifiques, de l'ARNt de levure et de l'héparine ont été ajoutés à 50 ug/ml et 5 mg/ml au tampon de liaison, respectivement. Les billes ont ensuite été centrifugées pendant 2 min à 1000 g, remis en suspension dans un tampon de liaison et reconditionné dans une colonne de 10 ml. La colonne a été abondamment lavée dans 5 × 20 ml de tampon de liaison comme suit : (1) tampon de liaison (2) tampon de liaison + 40 g/ml d'ARN de levure (3) tampon de liaison + 5 mg/ml d'héparine (4) tampon de liaison + 0,1% Triton X-100 et (5) tampon de liaison uniquement. Les protéines retenues sur la colonne d'affinité d'ARN ont été éluées par étape avec du tampon Hepes 20 mM, pH 7,4, contenant 0,5, 1 et 2 M de KCl. Les protéines éluées ont été analysées par SDS-PAGE et essai de décalage de bande.

Production d'anticorps de rat anti-ZBP2

La fraction d'élution de 2-M KCl de la colonne d'affinité du code postal a été concentrée avec un filtre centricon-30 et électrophorèse dans 10 % de SDS-PAGE. Après coloration au bleu de Coomassie, les bandes de protéines attendues ont été coupées du gel, broyées, mélangées à un adjuvant et injectées à des rats (Covance, Inc.) pour la production d'anticorps. Le titre de l'antisérum a été testé par immunoblot.

Immunobuvardage

Des aliquotes de protéines ont été résolues dans 10 % de SDS-PAGE et transférées sur des membranes Zeta par un buvard de transfert semi-sec (Bio-Rad Laboratories). Les membranes ont été tamponnées pendant une nuit avec du PBS contenant 5% de lait écrémé à 4°C puis incubées avec un antisérum contre ZBP2 (1:2000) dans du PBS contenant 1% de BSA pendant 2 h à température ambiante. Après trois lavages avec PBS/0,3% Tween-20, les membranes ont été incubées avec des anticorps de chèvre anti-rat conjugués à la peroxydase de raifort (1:8000), ZBP2 a été détecté avec le système ECL (Amersham Pharmacia Biotech) ou avec DAB/H2O2.

Immunoprécipitation et détection d'ARNm de -actine

10 µg d'anticorps purifiés ou 5 µl d'antisérum contre ZBP2 ont été incubés avec 100 µl d'extrait de protéine de cerveau pendant 1 h à 4°C sous agitation douce. 30 µl de billes d'agarose couplées à la protéine G (Pierce Chemical Co.) ont été ajoutés au mélange et incubés pendant encore 1 h à 4°C. Après centrifugation 5 min à 1500 g, le surnageant a été prélevé pour des tests d'immunotransfert et de décalage de bande d'ARN. Pour l'analyse de ZBP2, les billes d'agarose agglomérées ont été abondamment lavées avec du PBS et les protéines liées aux billes ont été éluées avec 100 pi de tampon d'élution ImmunoPure IgG (Pierce Chemical Co.). Pour détecter l'ARNm de la -actine, les billes d'agarose en boulettes ont été lavées trois fois avec du DEPC-PBS, remises en suspension dans 100 pi d'eau DEPC et bouillies pendant 10 min. L'ARN total a été extrait du surnageant en utilisant le réactif d'isolement d'ARN TRIzol (GIBCO BRL). La RT-PCR pour l'ARNm de la -actine a été réalisée pendant 20 cycles avec 1 ul d'ARN comme matrice en utilisant des billes de RT-PCR ReadyToGo (Amersham Pharmacia Biotech). Les amorces suivantes ont été utilisées pour l'amplification : 5' CTGACACCTTCACCATTCCAG 3' et 5' ATTGCTGACAGGATGCAGAAG 3'. Le produit de PCR attendu est un fragment d'ADN de 398 pb d'ARNm de -actine dans 3'UTR aux positions 1021-1419.

Isolement et clonage de l'ADNc de ZBP2

Deux amorces, zbp2–1 et zbp2–2, ont été conçues et synthétisées selon les deux séquences peptidiques (ZBP2 acides aminés 621–627 et 685–709, respectivement) et la séquence d'ADNc de KSRP humaine (zbp2–1 GCTTGGGAGGAGTACTACAA, zbp2–2 AGGACCTGGGGTCTGTCCGTA ) : Un fragment d'ADN de 200 pb a été amplifié à partir d'une banque de cerveaux d'embryons de poulet (CLONTECH Laboratories, Inc.) et vérifié par séquençage. Ce fragment a été utilisé pour le criblage de la banque de cerveaux d'embryons de poulet. Deux clones d'ADNc ont été isolés à partir du criblage de la banque. Après analyse de séquence, il était évident que les deux clones contenaient une séquence codante COOH-terminale de 500 pb suivie de 150 pb de 3'UTR. 5′ RACE PCR a été appliqué pour obtenir un NH2- Le fragment terminal de ZBP2 (CLONTECH Laboratories, Inc.) Les amorces RACE 4 ont été utilisées dans l'expérience 5' RACE (RACE6–1 : CACGCGGCGTTGGGGTCGGCTGC, RACE7 : TTATAGGCGGCCCA-CGGCGGCGTTGG, RACEF1 : GAACGCGTCCTTTGCCGGATCC, RACGCGGCGTTGGGGTCGGCTGC, RACE7 : TTATAGGCGGCCCA-CGGCGGCGTTGG, RACEF1 : GAACGCGTCCTTTGTCCCGGATCC, RACGCTGEF2 : CCTAATTCC). Les séquences des fragments d'ADN amplifiés par RACE ont été déterminées par des analyses automatisées des séquences d'ADN. Le gène complet a été épissé par PCR et confirmé par séquençage.

Hybridation in situ et immunocytochimie

L'hybridation in situ a été réalisée sur des fibroblastes comme décrit par Kislauskis et al. (1993), et sur les neurones comme décrit par Zhang et al. (1999). Des CEF de 9 jours ont été cultivés dans du MEM additionné de 10 % de FCS. Après avoir poussé sur des lamelles pendant 2 jours, les cellules ont été fixées dans du paraformaldéhyde à 4 % dans du PBS pendant 10 min et perméabilisées avec 0,5 % de Triton X-100 pendant 10 min supplémentaires à température ambiante. La distribution de ZBP2 dans les CEF a été visualisée par incubation d'un antisérum de rat contre ZBP2 (1:800) suivi d'anticorps de lapin anti-rat conjugués à Cy3 ou FITC (1:500 Jackson ImmunoResearch Lab). Les neurones ont été cultivés dans des milieux conditionnés N2 avec 2 % de sérum bovin fœtal (FBS) pendant 2 ou 4 jours et fixés dans du paraformaldéhyde à 4 % dans du PBS pendant 15 min à température ambiante. Après perméabilisation avec 0,5% de Triton X-100, les cellules ont été incubées avec un antisérum de rat contre ZBP2 (1:750) suivi d'anticorps de lapin anti-rat marqués au Cy3 (1:750). Pour l'hybridation et l'immunochimie in situ, les cellules ont d'abord été traitées pour l'hybridation de l'ARNm de la -actine, lavées avec du PBS et immunocolorées comme décrit précédemment (Zhang et al., 1999). Les cellules ont été visualisées avec un Olympus B x 60 avec un objectif Plan Apo 1.4NA 60 x. Les images ont été acquises avec une caméra CCD refroidie, exploitée par le logiciel d'imagerie Espirit.

Constructions de protéines de fusion GFP

L'ADNc de KSRP humain (l'homologue du poulet ZBP2), un don de D. Black (Université de Californie à Los Angeles, Los Angeles, CA), a été sous-cloné au vecteur pEGFP C1 (CLONTECH Laboratories, Inc.) à EcoRI et Hind III des sites. (pGFP-KSRP). Toutes les autres constructions de fusion EGFP sont des ZBP2 de poulet pleine longueur ou tronquées. Le fragment du domaine central contenant la séquence aa 103-650, y compris la séquence 47-aa unique aux domaines ZBP2 et 4-KH, a été amplifié par PCR et cloné dans le vecteur pEGFP-C1 aux sites EcoRI et Xbal pour générer le plasmide pGFP-CD. Les domaines 4-KH de ZBP2 ont été clonés dans le vecteur pEGFP-C1 aux sites SalI et Xbal pour produire la construction pGFP-KH. La séquence unique 47-aa a été amplifiée par PCR et introduite dans pEGFPC1 à EcoRI Hind III (site pGFP-IN). Le domaine COOH-terminal, comprenant des acides aminés 650 au codon d'arrêt, a été excisé du plasmide pBS-LS2 (isolé du criblage de bibliothèque) en utilisant les sites EcoRI et Xhol et cloné dans le vecteur pEGFPC1, générant pGFP-CT. La ZBP2 pleine longueur a été clonée dans pEGFPC2 (CLONTECH Laboratories, Inc.) aux sites EcoRI et Hind III pour générer pGFP-FULL. La séquence unique 47-aa a été supprimée de la ZBP2 pleine longueur par PCR d'épissage en deux étapes, et a été clonée dans le vecteur pEGFPC2 par les sites EcoRI et Hind III pour générer pGFP-Δ47. Toutes les constructions mentionnées ci-dessus ont été vérifiées par séquençage d'ADN.

Transfection et imagerie des cellules transfectées

Les CEF ont été transfectés pendant 4 à 5 h avec des constructions GFP-ZBP2 en utilisant le réactif Effectene de Qiagen selon le protocole du fabricant. Les neurones cultivés ont été transfectés avec DOTAP comme décrit (Zhang et al., 1999). Une imagerie GFP avec ou sans FISH a été réalisée (Zhang et al., 1999). Pour les CEF, les signaux d'ARNm de GFP et de -actine ont été visualisés par microscopie à fluorescence à l'aide d'un microscope Olympus B×60 avec un objectif 60×, n.a. 1.4. Au moins 50 cellules transfectées ont été comptées par lamelle pour la localisation de l'ARNm de la -actine.

La fusion EGFP/ZBP2 exprimée dans les neurones a été identifiée à l'aide d'une microscopie à fluorescence (microscope inversé Nikon Eclipse) équipée d'un objectif Plan-Neofluar 60×, d'une optique de phase, d'une lampe à arc au mercure de 100 W et de filtres passe-bande HiQ (ChromaTech). Les images de fluorescence ont été immédiatement acquises dans un temps d'exposition constant (1 s) avec une caméra CCD refroidie qui a été exécutée par le logiciel informatique IP Lab. Le périmètre de chaque dendrite axonale (premiers 30 µm du corps cellulaire) a été tracé à l'aide d'une image de phase. La région d'intérêt a été transférée à l'image de fluorescence dans la même cellule, et l'intensité de fluorescence de l'ARNm de -actine a été mesurée par le logiciel IP Lab. L'intensité de fluorescence du retour sur investissement dans les cellules non transfectées sur la lamelle a été mesurée en tant que contrôle normal. Plus de 20 cellules dans chaque groupe ont été analysées.


ARN messager (ARNm)

L'ARN messager (ou ARNm) a le rôle principal dans la transcription, ou la première étape dans la fabrication d'une protéine à partir d'un plan d'ADN. L'ARNm est composé de nucléotides trouvés dans le noyau qui se réunissent pour former une séquence complémentaire à l'ADN qui s'y trouve. L'enzyme qui assemble ce brin d'ARNm est appelée ARN polymérase. Trois bases azotées adjacentes dans la séquence d'ARNm sont appelées codon et elles codent chacune pour un acide aminé spécifique qui sera ensuite lié à d'autres acides aminés dans le bon ordre pour former une protéine.

Avant que l'ARNm puisse passer à l'étape suivante de l'expression génique, il doit d'abord subir un traitement. Il existe de nombreuses régions de l'ADN qui ne codent pour aucune information génétique. Ces régions non codantes sont encore transcrites par l'ARNm. Cela signifie que l'ARNm doit d'abord couper ces séquences, appelées introns, avant de pouvoir être codé en une protéine fonctionnelle. Les parties de l'ARNm qui codent pour les acides aminés sont appelées exons. Les introns sont coupés par les enzymes et seuls les exons sont laissés. Ce brin d'information génétique désormais unique est capable de sortir du noyau et de pénétrer dans le cytoplasme pour commencer la deuxième partie de l'expression des gènes appelée traduction.


L'expression du gène


Les informations de codage dans les génomes sont transcrites par incréments correspondant à un ou quelques gènes. Les séquences d'ADN codant pour les gènes et régulatrices (agissant en cis) qui dirigent l'initiation, l'élongation et la terminaison de la transcription sont collectivement appelées unité de transcription. Les unités de transcription procaryotes, appelées opérons, contiennent plus d'un gène, codant souvent pour des protéines physiologiquement apparentées (Fig. 15-2A). Les opérons sont flanqués de séquences qui dirigent l'initiation et la terminaison de la transcription.La figure 15-2B montre une simple unité de transcription eucaryote codant pour la chaîne de l'hémoglobine humaine. Bien que seule une petite fraction de cette région code pour le polypeptide de la -globine, les séquences régulatrices adjacentes sont cruciales pour une expression correcte de la -globine. Les défauts génétiques entraînant une diminution de la production de -globine sont appelés -thalassémies. De telles mutations peuvent se produire soit dans la région codante, résultant en un polypeptide instable ou tronqué, soit dans les régions de contrôle adjacentes, conduisant à de faibles niveaux de transcription ou à un traitement aberrant de l'ARN nouvellement synthétisé (voir chapitre 16). Ainsi, l'unité de transcription peut être considérée comme une série de modules liés, qui doivent tous être fonctionnels pour que le gène soit transcrit au niveau correct.


L'ARN ribosomique eucaryote est synthétisé à partir d'un ensemble de gènes répétés en tandem sous la forme d'une seule molécule, qui est clivée et modifiée pour donner les ARN 28S, 5.8S et 18S finaux (Fig. 15-3). Ceux-ci sont assemblés, avec l'ARN 5S et environ 80 protéines, en ribosomes dans le nucléole. L'ARN de transfert est synthétisé dans le noyau et transporté vers le cytoplasme, où il est chargé d'acides aminés avant de participer à la synthèse des protéines (voir chapitre 17). Les snRNA sont synthétisés et traités dans le noyau. De là, ils migrent vers le cytoplasme, où ils acquièrent des protéines essentielles, puis retournent au noyau, où ils fonctionnent dans les réactions enzymatiques de traitement de l'ARN (épissage voir chapitre 16). La voie de traitement post-synthétique suivie par un transcrit particulier est dictée, en partie, par la machinerie de transcription qui est utilisée pour initier et allonger le transcrit et par certaines caractéristiques de l'ARN naissant.


(B, avec l'aimable autorisation d'Yvonne Osheim, Université de Virginie, Charlottesville.)


(B, fichier PDB : 1I50. Référence : Cramer P, Bushnell DA, Kornberg RD : Base structurelle de la transcription : ARN polymérase II à une résolution de 2,8 angströms. Science 292 : 1863–1876, 2001. D, De Zhang G, Campbell EA, Minakhin L, et al : Structure cristalline de l'ARN polymérase centrale de Thermus aquaticus à une résolution de 3,3 . Cellule 98 : 811–824, 1999.)


Le chargement de l'ARN polymérase sur l'ADN génomique double brin au niveau d'une séquence de promoteur est mieux compris chez les procaryotes et est d'abord discuté avant la discussion sur les eucaryotes. L'initiation se déroule en une série d'étapes définies (Fig. 15-1). Premièrement, l'holoenzyme se lie au promoteur double brin, formant ce qu'on appelle le complexe fermé. La spécificité et la force de cette interaction sont dictées par des contacts spécifiques à la séquence entre le facteur et les bases dans les éléments -10 et -35 du promoteur (Fig. 15-6). La deuxième étape de l'initiation est la formation d'un complexe ouvert dans lequel une région de 14 pb autour du site de démarrage de la transcription n'est pas appariée, produisant une bulle de transcription. Ce désappariement s'accompagne d'un changement de conformation de la polymérase qui positionne la matrice d'ADN simple brin dans le site actif et rétrécit la fente de liaison à l'ADN, fermant efficacement le clamp de la polymérase. Dans l'étape suivante, la matrice d'ADN dans les paires de bases du site actif avec les deux premiers ribonucléotides et la première liaison phosphodiester est catalysée. Ce processus est répété jusqu'à ce que l'ARN naissant atteigne une longueur de huit à neuf bases, moment auquel l'ajout de bases à la chaîne d'ARN en croissance entraîne la dissociation d'une base de l'hybride ARN-ADN, et l'ARN naissant commence à sortir à travers un canal à la surface de la polymérase. Le changement de conformation résultant de la polymérase conduit à la libération du facteur σ et à la formation d'un complexe ternaire stable (à trois voies) contenant l'ARN polymérase, la matrice d'ADN et l'ARN naissant.


Les GTF d'ARN polymérase II comprennent plus de 20 polypeptides avec un poids moléculaire global de plus de 106 D (tableau 15-1). Avant que l'ARN polymérase II puisse initier la transcription in vitro, un assemblage ordonné de facteurs au niveau du promoteur doit se produire. L'assemblage du complexe de pré-initiation de l'ARN polymérase II commence par la liaison de TFIID, un facteur important (˜700 kD) constitué de la protéine de liaison à la boîte TATA (TBP) et d'un ensemble de facteurs associés à la TBP appelés TAFII (Fig. 15-7A) . Le TBP seul est suffisant pour la transcription basale, tandis que les TAF servent apparemment de cibles pour une activation ultérieure de la transcription (voir les sections suivantes). Le TBP est le premier polypeptide de la machinerie de transcription basale à reconnaître une séquence d'ADN spécifique au cours du processus d'initiation. La liaison à l'ADN est assurée par un domaine C-terminal de 180 acides aminés hautement conservé, qui forme un monomère en forme de selle avec un axe de symétrie dyade (Fig. 15-7B). La face inférieure de la « selle » TBP se lie au petit sillon de la séquence TATA, qui s'ouvre au cours du processus. Une courbure prononcée de l'ADN est produite à chaque extrémité de l'élément TATAAA par l'intercalation des chaînes latérales de la phénylalanine (Fig. 15-7C).


(B–D, fichier PDB : 1VOL. Coordonnées TBP + ADN avec l'aimable autorisation de Stephen Burley, Rockefeller University, New York.)


Résultats

Identification des protéines de liaison au code postal

Pour identifier les protéines qui se lient au code postal de l'ARNm de β-actine, des approches de déplacement de la mobilité de l'ARN et de réticulation UV ont été utilisées (Ross et al., 1997). Des transcrits de code postal radiomarqués ont été utilisés pour les tests de déplacement de la mobilité de l'ARN. Trois complexes ARN-protéines distincts ont été formés lorsque la sonde de code postal marquée a été incubée avec des extraits de cerveau ou de fibroblastes (Fig. 1 A, les complexes des pistes 1 & # x020134 sont indiqués par des flèches). L'intensité des complexes déplacés était proportionnelle à la quantité d'extrait de cerveau utilisé (pistes 1𠄳). Le complexe à migration rapide (F) a été observé dans les extraits de cerveau et de fibroblastes (pistes 3 et 4, respectivement). Cependant, les deux complexes à migration plus lente (M et S) étaient plus évidents dans le cerveau que dans les extraits de fibroblastes (pistes 3 et 4). La spécificité des complexes a été déterminée par des tests de compétition dans lesquels un excès de 100 fois de code postal non marqué était en compétition avec la formation des complexes (piste 5), tandis qu'un excès de 100 fois d'ARN non marqué transcrit à partir du vecteur pGEM 3Z n'a pas interféré avec le complexe formation (données non publiées).

Caractérisation des protéines se liant au code postal dans des extraits de cerveau d'embryon de poulet et de fibroblastes. (UNE). Complexes formés à partir du cerveau et des fibroblastes. Les transcrits marqués au [32P] codant pour le code postal 54 nts de l'UTR 3′ de l'ARNm de l'actine β de poulet ont été incubés avec des aliquotes d'extraits de cerveau d'embryon de poulet et de protéines de fibroblaste, suivis d'une incubation avec la RNase T1 (50 U/ml ) et de l'héparine (5 mg/ml). Les complexes ARN–protéines ont été résolus dans des gels natifs de polyacrylamide à 4 % qui ont ensuite été séchés et exposés à un film radiographique Kodak. (Pistes 1, 2 et 3) Transcription marquée au [32P] incubée avec des extraits de cerveau 1, 2 et 5-μl, respectivement. (Piste 4) Transcription marqué au [32P] incubé avec un extrait de fibroblaste 5 μl. (Piste 5) Transcription marquée au [32P] incubée avec un extrait de cerveau 5-μl en présence de 100 de quantités molaires en excès de 3߰ UTR non marqués de transcrits d'ARNm d'actine. Les flèches pointent vers les complexes de protéines à ARN lent (S), moyen (M) et à migration rapide (F). (B) Spécificité des complexes pour le code postal. (Piste 1) Code postal incubé avec un extrait de cerveau. (Piste 2) Code postal mutant incubé avec un extrait de cerveau. (C) essai de réticulation UV. Les transcrits marqués au [32P] ont été incubés avec un extrait de cerveau, traités avec la RNase T1 et exposés à la lumière UV pendant 3 min à une distance de 1 cm. Chacun des complexes ARN-protéines (F, M et S) a été identifié et excisé à partir d'un gel natif de polyacrylamide à 4 %, trempé dans du tampon SDS et résolu en SDS-PAGE à 10 %. (Trois voies à gauche) Complexes protéiques d'ARN excisés F, M et S qui n'étaient pas réticulés aux UV. (Trois voies à droite) Complexes protéiques d'ARN excisés F, M et S qui ont été réticulés. Les flèches indiquent les mobilités des protéines avec l'ARN marqué lié.

Parce qu'un code postal muté n'a pas réussi à localiser l'ARNm rapporteur (Ross et al., 1997), nous avons pensé que le code postal mutant ne formerait pas un complexe ARN–protéine. Pour tester cela, nous avons généré un code postal mutant radiomarqué dans lequel les deux motifs ACACCC ont été remplacés par GTGTGT, et nous avons effectué des tests de déplacement de la mobilité de l'ARN avec des extraits de cerveau (Fig. 1 B). Contrairement au code postal de type sauvage (piste 1), le code postal mutant n'a pas réussi à former des complexes ARN-protéines (Fig. 1 B, piste 2). Cela a indiqué que les protéines de l'extrait de cerveau ne se sont pas liées au code postal mutant et a démontré qu'une mutation qui altère la localisation de l'ARNm peut être corrélée à une liaison altérée de la protéine de liaison à l'ARN. Pour distinguer les composants protéiques qui se lient au code postal, nous avons utilisé les UV pour réticuler les complexes protéiques d'ARN formés en mélangeant le code postal radiomarqué avec des extraits de cerveau, et analysé les complexes par SDS-PAGE. Les trois complexes ARN–protéines n'étaient pas détectables sans réticulation (Fig. 1 C, pas d'UV-X). Lorsque les complexes ARN–protéines ont été réticulés et stabilisés, des bandes spécifiques ont été visualisées (UV-X). Le complexe F contenait une protéine réticulée avec une masse moléculaire estimée à � kD, la même masse moléculaire que ZBP1 (Ross et al., 1997). Les complexes M et S (les bandes enrichies dans le cerveau) contenaient une protéine réticulée avec une masse moléculaire estimée à � kD. La différence de migration des complexes M et S dans le gel natif et l'identité de la masse moléculaire sur SDS-PAGE suggèrent que le complexe S pourrait être un dimère du complexe M. À partir de ces données, nous concluons que les protéines de 68 et 92 kD se lient au code postal, le signal de localisation de l'ARNm de l'actine β. La bande de 68 kD est probablement ZBP1, mais l'autre ZBP est préférentiellement exprimée dans le cerveau. La protéine de 92 kD a été nommée ZBP2. Le fait qu'ils se séparent en complexes séparés indique que ZBP1 et ZBP2 ne se lient pas simultanément au code postal.

Purification des ZBP

Pour identifier la protéine enrichie dans le cerveau, nous avons purifié les ZBP en utilisant des techniques de sélection par affinité d'ARN. Nous avons passé des extraits de cerveau ou de fibroblastes cultivés sur une colonne de chromatographie d'affinité contenant l'ARN du code postal. Après des lavages extensifs, les protéines retenues sur la colonne ont été éluées avec des étapes croissantes de concentration en sel et analysées par SDS-PAGE avec coloration à l'argent (figure 2A). Bien que l'extrait de départ et la fraction d'écoulement soient hétérogènes (Fig. 2 A, piste 1), après une série de lavages (pistes 2&# x020135), des protéines spécifiques ont été éluées avec des conditions salines croissantes ( Fig. 2 A, pistes 7&# x020139). La fraction protéique éluée avec 1 et 2 M de KCl contenait des bandes de protéines distinctes (Fig. 2A, pistes 8 et 9, flèches), trois protéines étaient de � kD et une était de 92 kD. Les masses moléculaires estimées étaient en accord étroit avec celles des complexes ARN-protéines réticulés aux UV identifiés par SDS-PAGE (Fig. 1 B). Une protéine de masse moléculaire inférieure (53 kD) avait également été détectée précédemment (Ross et al., 1997).

Analyse des protéines fractionnées par chromatographie d'affinité ARN. (A) Analyse SDS-PAGE. Des aliquotes (30 μl) de protéines dans chaque étape de purification éluées de la chromatographie d'affinité d'ARN ont été résolues dans 10 % SDS-PAGE. (Piste 1) Fraction d'écoulement. (Lanes 2&# x020136) Protéines dans cinq étapes de lavage successives, respectivement. (Pistes 7𠄹) Protéines dans des fractions d'élution de 0,5, 1,0 et 2,0 KCl, respectivement. La masse moléculaire des protéines est marquée à la bonne position. Les petites flèches indiquent les cinq protéines qui ont été microséquencées. (B) Test de décalage sur gel en utilisant les protéines sélectionnées par affinité. Des aliquotes (5 μl) de chacun comme dans A (fraction) ont été incubées avec 1 × 10 5 CPM de transcrit de code postal marqué au [32 P] et les complexes formés ont été résolus dans des gels natifs à 4 %. (C) Matière de départ. Les flèches représentent les complexes ARN–protéines identifiés sur la figure 1 A.

Pour déterminer si les protéines éluées de la colonne d'affinité d'ARN contenaient une activité de liaison à l'ARN, nous avons effectué le test de déplacement de la mobilité de bande en incubant le code postal radiomarqué avec des protéines de chacune des étapes de purification (Fig. 2 B). En comparaison avec le matériau de départ (figure 2B, piste C), une activité de liaison à l'ARN améliorée a été détectée dans les fractions KCl 1- et 2-M (pistes 7 et 8). L'activité de liaison à l'ARN n'a pas été trouvée dans l'écoulement (Fig. 2 B, piste 2), les étapes de lavage ( Fig. 2 B, pistes 3 & 020136) et la fraction KCl 0,5-M ( Fig. 2 B, piste 6 ), indiquant que les protéines de liaison à l'ARN étaient enrichies dans les fractions KCl 1 et 2-M après purification par affinité de l'ARN. Étonnamment, bien que les fractions de KCl 1 et 2-M contiennent des protéines de 92 et 68 kD, après incubation avec le code postal radiomarqué, seuls les complexes M et S se sont formés (Fig. 2 B, pistes 8 et 9). L'absence relative de complexe F dans le test de décalage de bande a suggéré soit que la protéine de 68 kD a perdu son activité de liaison à l'ARN dans les conditions d'élution salines élevées, soit que la liaison de la protéine de 68 kD au code postal nécessite des protéines supplémentaires absentes ou actif dans la fraction saline élevée.

Microséquençage de protéines purifiées par affinité

Les protéines dans la fraction KCl 2-M de la colonne d'affinité d'ARN (Fig. 2A, piste 9) ont été concentrées avec un filtre centricon-30, résolues dans 12% SDS-PAGE et visualisées par coloration au bleu de Coomassie. Quatre bandes de protéines de �, 70, 65 et 45 kD ont été éluées du gel et microséquencées. Six peptides de la protéine purifiée de 92 kD, que nous avons nommée ZBP2, ont été obtenus après microséquençage. Une recherche dans la base de données avec les séquences peptidiques de ZBP2 a révélé que les six peptides correspondaient à une protéine nucléaire humaine, KSRP, qui a été précédemment identifiée comme un facteur d'épissage régulateur (Min et al., 1997). Les trois autres protéines ont également été identifiées par leurs séquences peptidiques. La protéine de 70 kD était un homologue d'une protéine humaine, la FBP, connue comme facteur de transcription pour la c-myc gène (Duncan et al., 1994). La protéine de 65 kD était une protéine inconnue. Nous n'avons pas séquencé la protéine de 68 kD, car nous avons supposé que cette protéine était ZBP1 (Ross et al., 1997). La protéine de 45 kD a été identifiée comme étant ssDBF, un facteur de liaison à l'ADN simple brin chez le poulet (Smidt et al., 1995), et était homologue à une protéine humaine, ABBP, une protéine hnRNP de type A/B qui joue un rôle dans Édition d'ARNm (Lau et al., 1997).

Isolement de l'ADNc de poulet pour ZBP2

La ZBP2 codant pour l'ADNc a été obtenue par criblage de trois banques d'ADNc de poulet et amplification rapide des extrémités d'ADNc (RACE)-amplification PCR de l'extrémité 5߰. La ZBP2 et la KSRP humaine partagent �% d'identité dans la séquence d'acide nucléique et 㺆% d'identité dans la séquence d'acides aminés (aa) (Fig. 3), indiquant que ZBP2/KSRP est une protéine hautement conservée. Comme avec KSRP et ZBP1 humains, ZBP2 contient également quatre domaines de liaison à l'ARN (KH) d'homologie hnRNP de type K et une région COOH-terminale enrichie en glutamines, avec quatre répétitions d'un motif AWEEYYK et d'un NH2domaine riche en proline-glycine -terminal (Fig. 3). Cependant, le poulet ZBP2 contient un segment 47-aa avant le premier domaine KH non trouvé dans KSRP, et des différences de séquence significatives à l'extrémité 5&# de l'ARNm.

Séquence complète de ZBP2 par rapport à la KSRP humaine. Les protéines dans la fraction d'élution de 2,0 KCl de la colonne d'affinité d'ARN comme le montre la figure 2 ont été concentrées avec un filtre contricon-30 (Amicon) et soumises à une électrophorèse dans 10 % de SDS-PAGE. Les protéines visualisées par coloration au bleu de Coomassie ont été excisées pour le microséquençage. Les séquences soulignées montrent les cinq peptides microséquencés de 16, 13, 13, 7 et 24 aa de ZBP2 purifiée (92 kD). Les régions rouges indiquent les quatre domaines d'homologie K hautement conservés du hnRNP. Notez la proline, riche en glycine NH2-terminaux et les domaines COOH-terminaux riches en glutamine de ZBP2. L'identité de ZBP2 et KSRP est de 86%. ZBP2 est disponible chez GenBank/EMBL/DDBJ/numéro d'accession. <"type":"entrez-nucleotide","attrs":<"text":"AF461020","term_id":"18252631">>AF461020.

ZBP2 est associé au code postal dans le cerveau et les fibroblastes de poulet

Pour faciliter nos études sur le rôle de ZBP2 pour la localisation de l'ARNm, nous avons généré des anticorps en injectant du ZBP2 purifié sur gel à des rats. La spécificité des anticorps ZBP2 a été déterminée par une analyse de transfert Western (Fig. 4 A), dans laquelle les anticorps de rat contre ZBP2 reconnaissaient spécifiquement ZBP2 dans les extraits de fibroblastes et de cerveau, ainsi que dans les fractions de protéines purifiées par affinité ( Fig. 4 A, voies 1𠄳).

Caractérisation des anticorps anti-ZBP2. Des anticorps contre ZBP2 ont été fabriqués en injectant de la ZBP2 purifiée sur gel SDS-PAGE à des rats. (A) Western blot à ZBP2. (Piste 1) Extrait brut de cerveau. (Piste 2) Extrait brut de fibroblaste. (Piste 3) 1,0 M de fraction protéique purifiée par affinité de KCl d'extrait de cerveau. La flèche indique ZBP2. (B) L'antisérum contre ZBP2 ou le sérum pré-immun a été incubé avec un extrait de cerveau pendant 2 h, suivi d'une incubation avec des billes d'agarose-protéine G pendant 2 h à 4 ° C. Les surnageants, après centrifugation à 1 500 tr/min pendant 10 min, ont été analysés par test de déplacement de motilité pour leur capacité à former un complexe ARN-protéine. (Piste 1) Extrait de cerveau de contrôle. (Piste 2) Extrait de cerveau incubé avec du sérum pré-immun de rat. (Piste 3) Extrait de cerveau incubé avec du sérum anti-ZBP2. Les flèches indiquent les complexes ARN&# x02013protéines identifiés sur la figure 1 A. (C) Les mêmes échantillons que dans B ont été utilisés pour le transfert de Western. (Piste 1) Extrait de cerveau de contrôle. (Piste 2) Extrait de cerveau incubé avec du sérum pré-immun de rat. (Piste 3) extrait de cerveau immunodéplété à l'aide de sérum anti-ZBP2. La flèche indique ZBP2.

Pour nous assurer que ZBP2 dans les extraits cérébraux était la protéine qui formait les complexes M et S avec le code postal, nous avons immunodéplété ZBP2 à partir d'extraits cérébraux et effectué des tests de déplacement de la mobilité de l'ARN pour détecter les complexes ARN-protéines (Fig. 4 B). Lorsque les surnageants d'une immunoprécipitation avec des anticorps ZBP2 ont été incubés avec le code postal, les complexes ARN spécifiques M et S ont été considérablement réduits (Fig. 4 B, piste 3). L'immunoprécipitation avec des anticorps anti-ZBP2 semble être spécifique, car le complexe F n'est que légèrement réduit (Fig. 4B, piste 3). En revanche, lorsque le test de déplacement de la mobilité de l'ARN a été effectué avec les surnageants après immunoprécipitation par un sérum pré-immun de rat témoin, aucune réduction de l'intensité des complexes ARN-protéines attendus n'a été trouvée (Fig. 4 B, piste 2). Ceci a confirmé que la formation des complexes M et S était dépendante de la présence de ZBP2. La formation du complexe F était probablement dépendante de ZBP1, qui n'est pas reconnue par les anticorps ZBP2. Pour vérifier que ZBP2 était immunodéplétée à partir d'extraits avec des anticorps anti-ZBP2, les mêmes surnageants utilisés dans le test de déplacement de mobilité ci-dessus ont été analysés par Western blot (figure 4C). Le résultat a montré que contrairement aux surnageants de contrôle et de sérum pré-immun de rat traités (Fig. 4 C, pistes 1 et 2), ZBP2 avait été éliminée par les anticorps anti-ZBP2 (Fig. 4 C, piste 3).

Régulation du développement de ZBP2

Pour déterminer le modèle d'expression de ZBP2 dans les neurones en développement, des extraits de protéines ont été préparés à partir de différents stades de développement de cerveau de poulet et analysés pour les niveaux de ZBP2 par Western blot (Fig. 5). L'expression la plus élevée de ZBP2 a été observée dans les embryons de 6 jours (Fig. 5, ​, 6 6 d), le niveau d'expression a été réduit à 30% avant l'éclosion et est resté stable par la suite (Fig. 5). En revanche, la quantité de protéine β-actine est presque constante aux mêmes moments. Ceci est cohérent avec les événements au cours de l'embryogenèse neurale, lorsque les axones et les dendrites sont à une croissance maximale, et coïncide également avec l'expression de ZBP1 (données non publiées).

Expression embryonnaire de ZBP2. Les protéines ont été extraites de cerveaux d'embryons de poulet à différents stades et analysées sur SDS-PAGE à 10 % avant transfert Western en utilisant des anticorps ZBP2 et β-actine.Les ratios relatifs de ZBP2 par intensité d'actine ont été calculés pour les stades indiqués (en jours).

Distribution de β-ARNm d'actine et ZBP2 dans les CEF et les neurones. Les CEF (A) et les neurones (B) ont été cultivés et fixés comme décrit dans Matériels et méthodes. Les cellules ont été hybridées in situ à l'ARNm de l'actine β (Cy3, rouge) et par immunofluorescence à la ZBP2 (FITC, vert). Le chevauchement est indiqué à droite de A et de B. L'image en B est une simple section optique déconvoluée superposée. Les pointes de flèches montrent la colocalisation de l'ARNm ZBP2 et β-actine dans les processus neuronaux et le cône de croissance. Barres, 10 μm.

Localisation cellulaire de ZBP2

Pour étudier la localisation subcellulaire de ZBP2 et si ZBP2 était associé à l'ARNm de β-actine in vivo dans les fibroblastes et les neurones, nous avons effectué un test combiné, en utilisant une hybridation in situ avec des sondes oligonucléotidiques marquées par fluorescence pour l'ARNm de β-actine (Fig. 6 en rouge, A , panneau de gauche et B) et avec des anticorps pour ZBP2 (Fig. 6, A en vert, panneau du milieu et B). La ZBP2 est majoritairement présente dans les noyaux cellulaires. Cependant, occasionnellement, une quantité importante de ZBP2 a été détectée par immunofluorescence dans le bord d'attaque des CEF et le cône de croissance des neurones en développement de poulet. Nous avons superposé leurs images (Fig. 6, A, à droite et B) où les ARNm ZBP2 et β-actine se chevauchaient (jaune) dans le bord d'attaque des CEF (Fig. 6 A, à droite) et le cône de croissance des neurones (Fig. 6B, flèches). Cela a fourni la preuve que l'ARNm de ZBP2 et β-actine étaient spatialement associés in vivo dans les cellules examinées. Bien que la protéine et l'ARN soient généralement distribués dans la même région des neurites, ils se chevauchent parfois. L'ARNm de l'actine β et la ZBP2 présentent une distribution ponctuée, particulièrement évidente dans les neurones, cohérente avec les observations de particules de localisation (Ainger et al., 1993 Zhang et al., 2001).

Les ARNm ZBP2 et β-actine sont physiquement associés

Pour déterminer si l'ARNm de ZBP2 et de β-actine pouvait être physiquement associé, nous avons utilisé une immunoprécipitation suivie de tests RT-PCR pour déterminer si le culot immunoprécipité avec des anticorps anti-ZBP2 contenait de l'ARNm de β-actine (Fig. 7). L'ARN a été isolé du culot immunoprécipité d'extrait de cerveau en utilisant soit des anticorps anti-ZBP2 soit du sérum pré-immun de rat, puis soumis à une RT-PCR. Un fragment de 398 pb de la région non traduite (UTR) de l'ARNm β-actine 3′ a été choisi pour l'amplification par PCR. Nous avons utilisé un plasmide sans ADNc de β-actine comme contrôle négatif (Fig. 7, piste 1) et un plasmide avec l'ADNc de β-actine comme contrôle positif (Fig. 7, piste 6). Un fragment de l'UTR 3′ de l'ARNm de β-actine a été amplifié à partir des immunoprécipitations avec un antisérum ZBP2 ou des anticorps (Fig. 7, pistes 3 et 5). Les immunoprécipitations avec du sérum de rat pré-immun ou des IgG n'ont démontré aucun fragment d'ADN amplifié par PCR (figure 7, pistes 2 et 4). Cette expérience a indiqué que l'ARNm de l'actine β et la ZBP2 étaient très probablement physiquement associés l'un à l'autre dans des extraits de cerveau de poulet.

βL'ARNm de l'actine a été coprécipité avec ZBP2. Des anticorps ZBP2 ont été utilisés pour immunoprécipiter un extrait de CEF. Des amorces d'ARNm de β-actine ont été utilisées dans un test RT-PCK pour détecter la présence d'ARNm de β-actine dans les culots. (Piste 1) Contrôle PCR négatif sans amorces. (Piste 2) Sérum de rat pré-immun. (Piste 3) Antisérum ZBP2. (Piste 4) IgG normale de rat purifiée. (Piste 5) IgG ZBP2 purifiée par affinité. (Piste 6) Contrôle PCR positif utilisant l'ADNc pleine longueur de l'ARNm de l'actine β comme matrice. M est le marqueur moléculaire de l'ADN. La flèche indique le fragment d'ADN amplifié par PCR de l'UTR 3′ de l'ARNm de β-actine.

Des portions de ZBP2 peuvent déterminer la distribution nucléaire et cytoplasmique

Pour déterminer si ZBP2 fait la navette entre le noyau et le cytoplasme, nous l'avons fusionné à une protéine de fluorescence verte améliorée (EGFP) et analysé la compartimentation de la protéine fluorescente dans les fibroblastes et les neurones. Les différentes portions de ZBP2 qui ont été fusionnées à la GFP comprenaient le segment 47-aa (rouge), les quatre domaines KH centraux (bleu) et les répétitions COOH-terminales (gris) (Fig. 8 A). Différents domaines de ZBP2 contrôlent la compartimentation nucléaire ou cytoplasmique de l'EGFP qui lui est fusionnée (les nombres indiquent le pourcentage de cellules à fluorescence cytoplasmique dans les fibroblastes). Le domaine COOH-terminal ( Fig. 8 B) et quatre domaines KH ( Fig. 8 D) ont été distribués dans toute la cellule, alors que lorsque les 47 aa ont été ajoutés au domaine 4-KH, que nous appelons le domaine central, la localisation était presque entièrement nucléaire ( Fig. 8 C). Cela suggérait que le 47 aa déterminait la distribution nucléaire. Ceci a été confirmé en fusionnant le segment 47-aa à l'EGFP, qui est alors devenu exclusivement nucléaire (Fig. 8 E). L'inspection du segment 47-aa a révélé plusieurs résidus d'arginine suggérant un signal de localisation nucléaire (NLS). Lorsque la ZBP2 pleine longueur a été fusionnée à la GFP, avec ou sans le segment 47-aa (Fig. 8, F et G), la fluorescence nucléaire a diminué mais n'a pas été éliminée dans la construction sans 47 aa, et la fluorescence cytoplasmique a augmenté , indiquant que des NLS faibles existaient très probablement ailleurs dans la protéine. La distribution dans les fibroblastes pour ces deux dernières constructions a été quantifiée dans les neurones, et a donné les mêmes pourcentages de cellules à fluorescence cytoplasmique. Contrairement à la ZBP2, la KSRP humaine était entièrement nucléaire lorsqu'elle était fusionnée à la GFP et exprimée en CEF (données non publiées).

Distribution nucléaire versus cytoplasmique de ZBP2 dans les fibroblastes et les neurones. La structure du gène de ZBP2 est démontrée dans A. Barre rouge, barres bleues d'insertion 47-aa, barres grises des domaines KH, répétition COOH-terminale du motif AWEEYYK. Les différentes constructions de ZBP2 la pleine longueur avec ou sans l'insert 47-aa (F et G), l'insert 47-aa (E), les quatre domaines KH (D), le domaine central contenant les quatre domaines KH, et l'insert 47-aa (C) ou l'extrémité COOH de la protéine (B) ont été fusionnés à la GFP et la distribution cellulaire caractérisée. Les constructions sont détaillées dans les panneaux de gauche avec des distributions cellulaires dans les panneaux de droite. Le pourcentage de cellules avec un signal cytoplasmique a été caractérisé pour chaque construction en nombre sous chaque construction. Barres, 10 μm.

La surexpression du domaine central ZBP2 perturbe partiellement la localisation de l'ARNm de l'actine β dans les CEF et les neurones

Une troncature de la ZBP2, le domaine central, qui contenait � aa incluant les 47 aa avec quatre domaines KH (Fig. 8 C), a été transfectée dans des CEF. Nous avons postulé que les domaines KH seraient en compétition pour la liaison à l'ARN avec la ZBP2 pleine longueur, analogue à ZBP1 (données non publiées), et agiraient donc comme un négatif dominant pour la localisation de l'ARNm de l'actine β. Le signal EGFP dans les fibroblastes transfectés avec le tronc était principalement présent dans le noyau. La localisation de l'ARNm de l'actine β a été visualisée par hybridation in situ en fluorescence. Le pourcentage de cellules avec l'ARNm localisé de l'actine β a diminué approximativement de moitié dans les CEF transfectés (Fig. 9, en haut) contrairement aux cellules transfectées avec EGFP ou EGFP-KSRP comme contrôle (l'homologue ZBP2 humain). L'intensité du signal cytoplasmique de l'ARNm de β-actine n'a pas changé de manière significative, indiquant que l'exportation nucléaire de l'ARNm de β-actine n'était pas inhibée par la construction négative dominante (données non publiées). Dans les neurones en développement transfectés, cette troncature a également entraîné une diminution de 35% du signal d'ARNm de l'actine β dans les processus ou les cônes de croissance par rapport à l'expérience de contrôle (Fig. 9, milieu). Cela suggère que la surexpression de la ZBP2 tronquée, mais toujours nucléaire, affecte la localisation de l'ARNm de l'actine β. Pour démontrer que l'effet négatif dominant de la troncature de ZBP2 est spécifique, nous avons effectué des cotransfections à la fois de la ZBP2 pleine longueur et du domaine central dans les CEF. La délocalisation de l'ARNm de l'actine β dans les cellules transfectées a été partiellement sauvée en utilisant le ZBP2 de type sauvage (Fig. 9, en bas).

Une construction négative dominante ZBP2 supprime β-localisation de l'ARNm de l'actine. (Haut) Le pourcentage de CEF transfectés avec l'ARNm localisé de l'actine β. Les CEF ont été transfectés pendant 6 h suivis d'une hybridation in situ en fluorescence. Les cellules transfectées ont été notées pour la localisation de l'ARNm de l'actine β. GFP, vecteur pEGFPC1 GFP-CD, GFP fusionné avec le domaine central GFP-KSRP, GFP-humain KSRP Mock, pas de plasmide. Les barres montrent le pourcentage de cellules transfectées avec un ARNm localisé d'actine β dans chaque expérience. Au moins 50 cellules transfectées ont été comptées dans chaque lamelle, deux expériences chacune. (Au milieu) Le signal d'ARNm de l'actine β dans les processus neuronaux. Les expériences étaient parallèles à A, sauf que l'extrémité COOH de ZBP2 (GFP-CT) a été utilisée (figure 8, construction B). Le signal d'ARNm de l'actine β a été mesuré puis converti en unités de fluorescence. (En bas) Le pourcentage de CEF cotransfectés avec l'ARNm localisé de l'actine β. Les CEF ont été transfectés soit avec une seule construction (ZBP2 de type sauvage ou la construction du domaine central négatif dominant) soit avec les deux constructions de différents ratios (dominante négative vs sauvage 1:1 ou 1:4) pendant 6 h. Après FISH, les cellules transfectées ont été notées comme sur la figure 9A.


Nous sommes reconnaissants pour le financement reçu par le Centre d'excellence SymBioSys (Conseil de recherche KULeuven EF/05/007), la recherche fondamentale stratégique de l'Institut pour la promotion de l'innovation par la science et la technologie en Flandre dans le cadre de la subvention IWT-SBO 120050 ( NEMOA) et le FWO [Fonds pour la recherche scientifique – Flanders (Belgium)] à travers une bourse postdoctorale à HS.

Aiba, H. (2007). Mécanisme de silençage de l'ARN par liaison à Hfq de petits ARN. Cour. Avis. Microbiole. 10, 134�. doi: 10.1016/j.mib.2007.03.010

Anderson, P.E., Gober J.W. (2000). FlbT, le régulateur post-transcriptionnel de la synthèse de la flagelline chez Caulobacter crescentus, interagit avec la région 5’ non traduite de l'ARNm de la flagelline. Mol. Microbiole. 38, 41&# x0201352. doi: 10.1046/j.1365-2958.2000.02108.x

Arthur, D.C., Ghetu, A.F., Gubbins, M.J., Edwards, R.A., Frost, L.S. et Glover, J.N.M. (2003). FinO est un chaperon d'ARN qui facilite les interactions ARN sens-antisens. EMBO J. 22, 6346�. doi: 10.1093/emboj/cdg607

Aymerich, S., et Steinmetz, M. (1992). Déterminants de spécificité et caractéristiques structurales dans l'ARN cible des protéines bactériennes antiterminatrices de la famille BglG/SacY. Proc. Natl. Acad. Sci. ETATS-UNIS. 89, 10410�. doi: 10.1073/pnas.89.21.10410

Babitzke, P. (2004). Régulation de l'atténuation de la transcription et de l'initiation de la traduction par le contrôle allostérique d'une protéine de liaison à l'ARN : la Bacillus subtilis protéine TRAP. Cour. Avis. Microbiole. 7, 132�. doi: 10.1016/j.mib.2004.02.003

Babitzke, P., Bear, D.G. et Yanofsky, C. (1995). TRAP, la protéine d'atténuation de liaison à l'ARN trp de Bacillus subtilis, est une molécule de forme toroïdale qui lie les transcrits contenant des répétitions GAG ou UAG séparées par deux nucléotides. Proc. Natl. Acad. Sci. ETATS-UNIS. 92, 7916&# x020137920. doi: 10.1073/pnas.92.17.7916

Babitzke, P., Stults, J.T., Shire, S.J. et Yanofsky, C. (1994). TRAP, la protéine d'atténuation de liaison à l'ARN trp de Bacillus subtilis, est un complexe multi-sous-unités qui semble reconnaître les répétitions G/UAG dans les transcrits trpEDCFBA et trpG. J. Biol. Chem. 269, 16597�.

Bachem, S., et Stülke, J. (1998). Règlement de la Bacillus subtilis Protéine antiterminatrice GlcT par les composants du système phosphotransférase. J. Bactériol. 180, 5319�.

Bae, W., Xia, B., Inouye, M. et Severinov, K. (2000). Escherichia coli Les chaperons d'ARN de la famille CspA sont des antiterminateurs de transcription. Proc. Natl. Acad. Sci. ETATS-UNIS. 97, 7784�. doi: 10.1073/pnas.97.14.7784

Baker, C. S., Eöry, L. A., Yakhnin, H., Mercante, J., Romeo, T. et Babitzke, P. (2007). CsrA inhibe l'initiation de la traduction de Escherichia coli hfq en se liant à un seul site chevauchant la séquence Shine-Dalgarno. J. Bactériol. 189, 5472�. doi: 10.1128/JB.00529

Baker, C. S., Morozov, I., Suzuki, K., Romeo, T. et Babitzke, P. (2002). CsrA régule la biosynthèse du glycogène en empêchant la traduction de glgC dans Escherichia coli. Mol. Microbiole. 44, 1599&# x020131610. doi: 10.1046/j.1365-2958.2002.02982.x

Barria, C., Malecki, M. et Arraiano, C. M. (2013). Adaptation bactérienne au froid. Microbiologie 159, 2437�. doi: 10.1099/mic.0.052209-0

Beyer, D., Skripkin, E., Wadzack, J. et Nierhaus, K.H. (1994). Comment le ribosome se déplace le long de l'ARNm pendant la synthèse des protéines. J. Biol. Chem. 269, 30713�.

Brencic, A., et Lory, S. (2009). Détermination du régulon et identification de nouvelles cibles d'ARNm de Pseudomonas aeruginosa RsmA. Mol. Microbiole. 72, 612�. doi: 10.1111/j.1365-2958.2009.06670.x

Browne, P., Barret, M., O’Gara, F. et Morrissey, J.P. (2010). La prédiction informatique du régulon Crc identifie des cibles à l'échelle du genre et spécifiques à l'espèce du contrôle de la répression des catabolites dans Pseudomonas bactéries. BMC Microbiol. 10h300. doi: 10.1186/1471-2180-10-300

Burrowes, E., Baysse, C., Adams, C. et O’Gara, F. (2006). Influence de la protéine régulatrice RsmA sur les fonctions cellulaires dans Pseudomonas aeruginosa PAO1, révélée par l'analyse du transcriptome. Microbiologie 152, 405&# x02013418. doi: 10.1099/mic.0.28324-0

Callaghan, A.J., Marcaida, M.J., Stead, J.A., McDowall, K.J., Scott, W.G. et Luisi, B.F. (2005). Structure de Escherichia coli Domaine catalytique de la RNase E et implications pour le renouvellement de l'ARN. La nature 437, 1187&# x020131191. doi: 10.1038/nature04084

Carpousis, A. J. (2007). L'ARN dégradosome de Escherichia coli: une machine de dégradation des ARNm assemblée sur la RNase E. Annu. Rév. Microbiol. 61, 71�. doi: 10.1146/annurev.micro.61.080706.093440

Chai, W. et Stewart, V. (1999). Exigences de séquence d'ARN pour l'antiterminaison de la transcription médiée par NasR et sensible aux nitrates Klebsiella oxytoca Chef d'opéron M5al nasF. J. Mol. Biol. 292, 203&# x02013216. doi: 10.1006/jmbi.1999.3084

Chaulk, S., Lu, J., Tan, K., Arthur, D.C., Edwards, R.A., Frost, L.S., et al. (2010). N. meningitidis 1681 est un membre de la famille FinO des chaperons d'ARN. ARN Biol. 7, 812�. doi: 10.4161/rna.7.6.13688

Chaulk, S.G., Smith-Frieday, M.N., Arthur, D.C., Culham, D.E., Edwards, R.A., Soo, P., et al. (2011). ProQ est un chaperon d'ARN qui contrôle les niveaux de ProP dans Escherichia coli. Biochimie 50, 3095�. doi: 10.1021/bi101683a

Chen, Y. et Anderson, D. M. (2011). Hiérarchie des expressions dans le Yersinia système de sécrétion de type III établi par reconnaissance YopD de l'ARN. Mol. Microbiole. 80, 966&# x02013980. doi: 10.1111/j.1365-2958.2011.07623.x

Christiansen, J. K., Larsen, M. H., Ingmer, H., Søgaard-andersen, L. et Kallipolitis, B. H., (2004). La protéine de liaison à l'ARN Hfq de Listeria monocytogenes: rôle dans la tolérance au stress et la virulence. J. Bactériol. 186, 3355&# x020133362. doi: 10.1128/JB.186.11.3355-3362.2004

Cohen-Or, I., Shenhar, Y., Biran, D. et Ron, E. Z. (2010). CspC régule les niveaux de transcription rpoS et complète les délétions hfq. Rés. Microbiole. 161, 694&# x02013700. doi: 10.1016/j.resmic.2010.06.009

Davies, B.W., Köhrer, C., Jacob, A.I., Simmons, L.A., Zhu, J., Aleman, L.M., et al. (2011). Rôle de Escherichia coli YbeY, une protéine hautement conservée, dans le traitement de l'ARNr. Mol. Microbiole. 78, 506&# x02013518. doi: 10.1111/j.1365-2958.2010.07351.x

Deana, A., et Belasco, J.G. (2005). Perdu en traduction : l'influence des ribosomes sur la dégradation de l'ARNm bactérien. Gènes Dev. 19, 2526�. doi: 10.1101/gad.1348805

De Lay, N., Schu, D.J. et Gottesman, S. (2013). Régulation négative à base de petits ARN bactériens : Hfq et ses complices. J. Biol. Chem. 288, 7996�. doi: 10.1074/jbc.R112.441386

Desnoyers, G., Bouchard, M. P., et Massé, E. (2013). De nouvelles connaissances sur la régulation traductionnelle dépendante de l'ARN chez les procaryotes. Tendances Genet. 29, 92�. doi: 10.1016/j.tig.2012.10.004

Desnoyers, G., et Masse, E. (2012). Répression non canonique de l'initiation de la traduction par le recrutement de petits ARN de l'ARN chaperon Hfq. 42, 726�. doi: 10.1101/gad.182493.111

Du, H., et Babitzke, P. (1998). atténuation de la liaison à l'ARN trp Le repliement de l'ARN à longue distance médié par les protéines régule la traduction de trpE dans Bacillus subtilis. J. Biol. Chem. 273, 20494&# x0201320503. doi: 10.1074/jbc.273.32.20494

Du, H., Tarpey, R. et Babitzke, P. (1997). La protéine d'atténuation de liaison à l'ARN trp régule la synthèse de TrpG en se liant au site de liaison du ribosome trpG de Bacillus subtilis. J. Bactériol. 179, 2582�.

Dubey, A.K., Baker, C.S., Romeo, T. et Babitzke, P. (2005). La séquence d'ARN et la structure secondaire participent à l'interaction ARN de haute affinité CsrA –. ARN 11, 1579&# x020131587. doi: 10.1261/rna.2990205.3

Dubey, A.K., Baker, C.S., Suzuki, K., Jones, A.D., Pandit, P., Romeo, T., et al. (2003). CsrA réglemente la traduction des Escherichia coli gène de privation de carbone, cstA, en bloquant l'accès des ribosomes au transcrit cstA. J. Bactériol. 185, 4450�. doi: 10.1128/JB.185.15.4450-4460.2003

Edwards, A.N., Patterson-Fortin, L.M., Vakulskas, C.A., Mercante, J.W., Potrykus, K., Vinella, D., et al. (2011). Circuits reliant la RSE et les systèmes réglementaires mondiaux de réponse stricte. Mol. Microbiole. 80, 1561&# x020131580. doi: 10.1111/j.1365-2958.2011.07663.x

Even, S., Pellegrini, O., Zig, L., Labas, V., Vinh, J., Brຜhemmier-Baey, D., et al. (2005). Ribonucléases J1 et J2 : deux nouvelles endoribonucléases en B. subtilis avec homologie fonctionnelle avec E. coli RNase E. Acides nucléiques Res. 33, 2141�. doi: 10.1093/nar/gki505

Feng, Y., Huang, H., Liao, J. et Cohen, S.N. (2001). Escherichia coli les protéines de liaison poly(A) qui interagissent avec les composants des dégradosomes ou empêchent la décomposition de l'ARN médiée par la polynucléotide phosphorylase et la RNase E. J. Biol. Chem. 276, 31651�. doi: 10.1074/jbc.M102855200

Ferooz, J., Lemaire, J., et Letesson, J.-J. (2011). Rôle de la FlbT dans la production de flagelline en Brucella melitensis. Microbiologie 157, 1253&# x020131262. doi: 10.1099/mic.0.044867-0

Figueroa-Bossi, N., Schwartz, A., Guillemardet, B., D&# x02019Heyg&# x000E8re, F., Bossi, L., et Boudvillain, M. (2014). Le remodelage de l'ARN par le régulateur global bactérien CsrA favorise la terminaison de la transcription Rho-dépendante. Gènes Dev. 28, 1239&# x020131251. doi: 10.1101/gad.240192.114

Finn, R.D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R.Y., Eddy, S.R., et al. (2014). Pfam : la base de données des familles de protéines. Acides nucléiques Res. 42, D222�. doi: 10.1093/nar/gkt1223

Folichon, M. (2003). La protéine de liaison poly(A) Hfq protège l'ARN de la RNase E et de la dégradation exoribonucléolytique. Acides nucléiques Res. 31, 7302�. doi: 10.1093/nar/gkg915

Gaballa, A., Antelmann, H., Aguilar, C., Khakh, S. K., Song, K.-B., Smaldone, G. T., et al. (2008). Les Bacillus subtilis La réponse d'épargne du fer est médiée par un petit ARN régulé par Fur et trois petites protéines basiques. Proc. Natl. Acad. Sci. ETATS-UNIS. 105, 11927&# x0201311932. doi: 10.1073/pnas.0711752105

Geissmann, T.A., et Touati, D. (2004). Hfq, un nouveau rôle de chaperon : la liaison à l'ARN messager détermine l'accès des petits régulateurs d'ARN. EMBO J. 23, 396�. doi: 10.1038/sj.emboj.7600058

Gollnick, P., Babitzke, P., Antson, A. et Yanofsky, C. (2005). Complexité de la régulation de la biosynthèse du tryptophane chez Bacillus subtilis. Annu. le révérend Genet. 39, 47�. doi: 10.1146/annurev.genet.39.073003.093745

Göpel, Y., Papenfort, K., Reichenbach, B., Vogel, J. et Görke, B. (2013). Décroissance ciblée d'un petit ARN régulateur par une protéine adaptatrice pour la RNase E et neutralisation par un ARN anti-adaptateur. Gènes Dev. 27, 552�. doi: 10.1101/gad.210112.112

Hajnsdorf, E., et Boni, I. V. (2012). Activités multiples des protéines de liaison à l'ARN S1 et Hfq. Biochimie 94, 1544&# x020131553. doi: 10.1016/j.biochi.2012.02.010

Hajnsdorf, E., et Régnier, P. (2000). Facteur hôte Hfq de Escherichia coli stimule l'allongement des queues poly(A) par la poly(A) polymérase I. Proc. Natl. Acad. Sci. ETATS-UNIS. 97, 1501�. doi: 10.1073/pnas.040549897

Hämmerle, H., Amman, F., Veຎrek, B., Stülke, J., Hofacker, I. et Bläsi, U. (2014). Impact de Hfq sur le Bacillus subtilis transcriptome. PLoS UN 9:e98661. doi: 10.1371/journal.pone.0098661

Henderson, C.A., Vincent, H.A., Casamento, A., Stone, C.M., Phillips, J.O., Cary, P.D., et al. (2013). La liaison Hfq modifie la structure de Escherichia coli petits ARN non codants OxyS et RprA, qui sont impliqués dans la riborégulation de rpoS. ARN 19, 1089&# x020131104. doi: 10.1261/rna.034595.112

Herschlag, D. (1995). Les chaperons d'ARN et le problème de repliement de l'ARN. J. Biol. Chem. 270, 20871�. doi: 10.1074/jbc.270.36.20871

Hopkins, J. F., Panja, S. et Woodson, S. A. (2011). Liaison et libération rapides de Hfq à partir de complexes ternaires lors de l'annelage de l'ARN. Acides nucléiques Res. 39, 5193�. doi: 10.1093/nar/gkr062

Huttenhofer, A., et Fnolier, H. (1994). Empreinte des complexes ARNm-ribosome avec des sondes chimiques. EMBO J. 13, 3892&# x020133901.

Ikeda, Y., Yagi, M., Morita, T. et Aiba, H. (2011). La liaison de Hfq à la région de reconnaissance RhlB de la RNase E est cruciale pour la dégradation rapide des ARNm cibles médiée par les ARNs dans Escherichia coli. Mol. Microbiole. 79, 419&# x02013432. doi: 10.1111/j.1365-2958.2010.07454.x

Irie, Y., Starkey, M., Edwards, A.N., Wozniak, D.J., Romeo, T. et Parsek, M.R. (2010). Pseudomonas aeruginosa Le polysaccharide de matrice de biofilm Psl est régulé transcriptionnellement par RpoS et post-transcriptionnel par RsmA. Mol. Microbiole. 78, 158�. doi: 10.1111/j.1365-2958.2010.07320.x

Jacob, A.I., Köhrer, C., Davies, B.W., Rajbhandary, U.L. et Walker, G.C. (2014). La RNase bactérienne conservée YbeY joue un rôle clé dans le contrôle qualité du ribosome 70S et la maturation de l'ARNr 16S. Mol. Cellule 49, 427�. doi: 10.1016/j.molcel.2012.11.025

Jerome, L.J., van Biesen, T. et Frost, L.S. (1999). Dégradation de l'ARN antisens FinP à partir de plasmides de type F : la protéine de liaison à l'ARN, FinO, protège FinP de la ribonucléase E. J. Mol. Biol. 285, 1457�. doi: 10.1006/jmbi.1998.2404

Jonas, K., Edwards, A. N., Simm, R., Romeo, T., Römling, U. et Melefors, O. (2008). La protéine de liaison à l'ARN CsrA contrôle le métabolisme cyclique du di-GMP en régulant directement l'expression des protéines GGDEF. Mol. Microbiole. 70, 236�. doi: 10.1111/j.1365-2958.2008.06411.x

Jørgensen, M. G., Thomason, M. K., Havelund, J., Valentin-Hansen, P. et Storz, G. (2013). Double fonction du petit ARN McaS dans le contrôle de la formation de biofilm. Gènes Dev. 27, 1132&# x020131145. doi: 10.1101/gad.214734.113

Jutras, B.L., Chenail, A.M., Carroll, D.W., Miller, M.C., Zhu, H., Bowman A., et al. (2013a). Bpur, la protéine du domaine PUR du spirochète de la maladie de Lyme : identification en tant que modulateur transcriptionnel et caractérisation des interactions d'acide nucléique. J. Biol. Chem. 288, 26220�. doi: 10.1074/jbc.M113.491357

Jutras, B.L., Jones, G.S., Verma, A., Brown, N.A., Antonicello, A.D., Chenail, A.M., et al. (2013b). Autorégulation post-transcriptionnelle par la protéine de liaison à l'ADN/l'ARN BpuR de la bactérie de la maladie de Lyme. J. Bactériol. 195, 4915&# x020134923. doi: 10.1128/JB.00819-13

Kaberdin, V. R., Singh, D. et Lin-Chao, S. (2011). Composition et conservation de la machinerie de dégradation des ARNm chez les bactéries. J. Biomed. Sci. 18, 23. doi : 10.1186/1423-0127-18-23

Kawamoto, H., Koide, Y., Morita, T. et Aiba, H. (2006). Exigence d'appariement de bases pour l'extinction de l'ARN par un petit ARN bactérien et accélération de la formation de duplex par Hfq. Mol. Microbiole. 61, 1013�. doi: 10.1111/j.1365-2958.2006.05288.x

Kime, L., Jourdan, S. S., Stead, J. A., Hidalgo-Sastre, A. et McDowall, K. J. (2010). Clivage rapide de l'ARN par la RNase E en l'absence de stimulation par le monophosphate 5’. Mol. Microbiole. 76, 590�. doi: 10.1111/j.1365-2958.2009.06935.x

Koleva, R. I., Austin, C. A., Kowaleski, J. M., Neems, D. S., Wang, L., Vary, C. P. H., et al. (2006). Interactions de la protéine ribosomique S1 avec l'ARNm DsrA et rpoS. Biochimie. Biophys. Rés. Commun. 348, 662�. doi: 10.1016/j.bbrc.2006.07.102

Komarova, A.V., Tchufistova, L.S., Dreyfus, M. et Boni, I.V. (2005). Les séquences AU-riches au sein de 5 leaders non traduits améliorent la traduction et stabilisent l'ARNm dans Escherichia coli. J. Bactériol. 187, 1344&# x020131349. doi: 10.1128/JB.187.4.1344

Kopaskie, K.S., Ligtenberg, K.G. et Schneewind, O. (2013). Régulation translationnelle de Yersinia enterocolitica ARNm codant pour un substrat de sécrétion de type III. J. Biol. Chem. 288, 35478�. doi: 10.1074/jbc.M113.504811

Kovach, A.R., Hoff, K.E., Canty, J.T., Orans, J. et Brennan, R.G. (2014). Reconnaissance de l'ARN riche en U par Hfq du pathogène Gram-positif Listeria monocytogenes. ARN 20, 1548&# x020131559. doi: 10.1261/rna.044032.113

Kulkarni, P.R., Cui, X., Williams, J.W., Stevens, A.M. et Kulkarni, R.V. (2006). Prédiction des petits ARN régulant la CsrA chez les bactéries et leur vérification expérimentale chez Vibrio fischeri. Acides nucléiques Res. 34, 3361�. doi: 10.1093/nar/gkl439

Lawhon, S.D., Frye, J.G., Suyemoto, M., Porwollik, S., McClelland, M. et Altier, C. (2003). Réglementation mondiale par CsrA en Salmonelle typhimurium. Mol. Microbiole. 48, 1633&# x020131645. doi: 10.1046/j.1365-2958.2003.03535.x

Le Derout, J. (2003). Hfq affecte la longueur et la fréquence des courtes queues oligo (A) à la fin 3’ de Escherichia coli ARNm rpsO. Acides nucléiques Res. 31, 4017�. doi: 10.1093/nar/gkg456

Le Derout, J., Boni, I. V., Régnier, P., et Hajnsdorf, E. (2010). Hfq affecte les niveaux d'ARNm indépendamment de la dégradation. BMC Mol. Biol. 11h17. doi: 10.1186/1471-2199-11-17.

Link, T.M., Valentin-Hansen, P., et Brennan, R.G. (2009). Structure de Escherichia coli Hfq lié à l'ARN polyriboadénylate. Proc. Natl. Acad. Sci. ETATS-UNIS. 106, 19292&# x0201319297. doi: 10.1073/pnas.0908744106

Liu, J.M. et Camilli, A. (2010). Un monde qui s'élargit de petits ARN bactériens. Cour. Avis. Microbiole. 13, 18�. doi: 10.1016/j.mib.2009.11.004

Liu, M. Y., Gui, G., Wei, B., Preston, J. F., Oakford, L., Yuksel, U., et al. (1997). La molécule d'ARN CsrB se lie à la protéine régulatrice globale CsrA et antagonise son activité dans Escherichia coli. J. Biol. Chem. 272, 17502&# x0201317510. doi: 10.1074/jbc.272.28.17502

Liu, M. Y., Yang, H. et Romeo, T. (1995). Le produit du pléiotrope Escherichia coli Le gène csrA module la biosynthèse du glycogène via des effets sur la stabilité de l'ARNm. J. Bactériol. 177, 2663�.

Liu, Y., Wu, N., Dong, J., Gao, Y., Zhang, X., Mu, C., et al. (2010). Hfq est un régulateur mondial qui contrôle la pathogénicité des Staphylococcus aureus. PLoS UN 5:13069. doi: 10.1371/journal.pone.0013069

Lorenz, C., Gesell, T., Zimmermann, B., Schoeberl, U., Bilusic, I., Rajkowitsch, L., et al. (2010). Genomic SELEX pour les ARN de liaison à Hfq identifie les aptamères génomiques principalement dans les transcrits antisens. Acides nucléiques Res. 38, 3794�. doi: 10.1093/nar/gkq032

Lu, Y., Turner, R. et Switzer, R. (1996). Fonction des structures secondaires de l'ARN dans l'atténuation transcriptionnelle du Bacillus subtilis opéron pyr. Proc. Natl. Acad. Sci. ETATS-UNIS. 93, 14462�. doi: 10.1073/pnas.93.25.14462

Mackay, J.P., Font, J. et Segal, D.J. (2011). Les perspectives des concepteurs de protéines de liaison à l'ARN simple brin. Nat. Structurer. Mol. Biol. 18, 256�. doi: 10.1038/nsmb.2005

Mackie, G.A. (1998). La ribonucléase E est une endonucléase dépendante de 5 extrémités. La nature 395, 720�. doi: 10.1038/27246

Mackie, G.A. (2013). RNase E : à l'interface du traitement et de la désintégration de l'ARN bactérien. Nat. Rév. Microbiol. 11, 45�. doi: 10.1038/nrmicro2930

Mahadevan, S., et Wright, A. (1987). Un gène bactérien impliqué dans l'antiterminaison de la transcription : régulation au niveau d'un terminateur rho-indépendant dans l'opéron bgl d'E. coli. Cellule 50, 485�. doi: 10.1016/0092-8674(87)90502-2

Mallory, A., et Vaucheret, H. (2010). Forme, fonction et régulation des protéines ARGONAUTE. Cellule de plante 22, 3879�. doi: 10.1105/tpc.110.080671

Marden, J.N., Diaz, M.R., Walton, W.G., Gode, C.J., Betts, L., Urbanowski, M.L., et al. (2013). Un membre inhabituel de la famille CsrA opère en série avec RsmA pour amplifier les réponses post-transcriptionnelles dans Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. ETATS-UNIS. 110, 15055�. doi: 10.1073/pnas.1307217110

Massé, E., Escorcia, F. E. et Gottesman, S. (2003). Dégradation couplée d'un petit ARN régulateur et de ses cibles ARNm dans Escherichia coli. Gènes Dev. 19, 2374�. doi: 10.1101/gad.1127103

Merino, E., Babitzke, P., Yanofsky, C., Merino, E., Babitzke, P. et Yanofsky, C. (1995). Les interactions trp RNA-binding attenuation protein (TRAP)-trp leader RNA médient la régulation de la traduction et de la transcription de la Bacillus subtilis opéron trp. J. Bactériol. 177, 6362�.

Mikulecky, P.J., Kaw, M.K., Brescia, C.C., Takach, J.C., Darren, D. et Feig, A.L. (2004). Escherichia coli Hfq a des surfaces d'interaction distinctes pour les ARN DsrA, rpoS et poly(A). Nat. Structurer. Mol. Biol. 11, 1206&# x020131214. doi: 10.1038/nsmb858

Milojevic, T., Grishkovskaya, I., Sonnleitner, E., Djinovic-Carugo, K. et Bl&# x000E4si, U. (2013). Les Pseudomonas aeruginosa La protéine de contrôle de la répression des catabolites Crc est dépourvue d'activité de liaison à l'ARN. PLoS UN 8:e64609. doi: 10.1371/journal.pone.0064609

Mitobe, J., Yanagihara, I., Ohnishi, K., Yamamoto, S., Ohnishi, M., Ishihama, A., et al. (2011). RodZ régule le traitement post-transcriptionnel du Shigella sonnei système de sécrétion de type III. Représentant EMBO 12, 911�. doi: 10.1038/embor.2011.132

Mohanty, B.K., Maples, V.F. et Kushner, S.R. (2004). La protéine de type Sm Hfq régule la dégradation de l'ARNm dépendante de la polyadénylation dans Escherichia coli. Mol. Microbiole. 54, 905�. doi: 10.1111/j.1365-2958.2004.04337.x

Moll, I., Afonyushkin, T., Vytvytska, O. et Kaberdin, V. R. (2003). Sites coïncidents de liaison Hfq et de clivage de la RNase E sur l'ARNm et les petits ARN régulateurs. ARN 11, 1308&# x020131314. doi: 10.1261/rna.5850703

Møller, T., Franch, T., Højrup, P., Keene, D.R., Ba, H.P., Brennan, R.G., et al. (2002). Hfq : une protéine bactérienne de type sm qui médie l'interaction ARN-ARN. Mol. Cellule 9, 23�. doi: 10.1016/S1097-2765(01)00436-1

Moreno, R., Hernández-Arranz, S., La Rosa, R., Yuste, L., Madhushani, A., Shingler, V., et al. (2014). Les protéines Crc et Hfq de Pseudomonas putida coopérer dans la répression des catabolites et la formation de complexes d'acide ribonucléique avec des motifs cibles spécifiques. Environ. Microbiole. 17, 105�. doi: 10.1111/1462-2920.12499

Moreno, R., Marzi, S., Romby, P. et Rojo, F. (2009). Le régulateur global Crc se lie à un motif riche en A non apparié au Pseudomonas putida alkS mRNA codant la séquence et inhibe l'initiation de la traduction. Acides nucléiques Res. 37, 7678�. doi: 10.1093/nar/gkp825

Morita, T., Maki, K. et Aiba, H. (2005). Complexes ribonucléoprotéiques à base de RNase E : base mécanique de la déstabilisation de l'ARNm médiée par des ARN bactériens non codants. Gènes Dev. 19, 2176�. doi: 10.1101/gad.1330405.1996

Morris, E. R., Hall, G., Li, C., Heeb, S., Kulkarni, R. V., Lovelock, L., et al. (2013). Réarrangement structurel dans un orthologue RsmA/CsrA de pseudomonas aeruginosa crée une protéine de liaison à l'ARN dimère, RsmN. Structure 21, 1659&# x020131671. doi: 10.1016/j.str.2013.07.007

Mu󻁎r, A., Fischer, D., et Hengge-Aronis, R. (1996). La protéine de liaison à l'ARN HF-I, connue comme un facteur hôte pour la réplication de l'ARN du phage Qbeta, est essentielle pour la traduction de rpoS dans Escherichia coli. Gènes Dev. 10, 1143&# x020131151. doi: 10.1101/gad.10.9.1143

Mukherjee, S., Yakhnin, H., Kysela, D., Sokoloski, J., Babitzke, P. et Kearns, D. B. (2011). L'interaction CsrA-FliW régit l'homéostasie de la flagelline et un point de contrôle sur la morphogenèse flagellaire dans Bacillus subtilis. Mol. Microbiole. 82, 447&# x02013461. doi: 10.1111/j.1365-2958.2011.07822.x

Muto, Y., Oubridge, C. et Nagai, K. (2000). Protéines de liaison à l'ARN : piégeage des bases d'ARN. Cour. Biol. 10, 19&# x0201321. doi: 10.1016/S0960-9822(99)00250-X

Osborne, J., Djapgne, L., Tran, B. Q., Goo, Y. A. et Oglesby-Sherrouse, A. G. (2014). Méthode d'identification in vivo de petites protéines bactériennes liant l'ARN. Microbiologieopen 3, 950&# x02013960. doi: 10.1002/mbo3.220

Pandey, P, S., Winkler, J. A., Li, H., Camacho, D. M., Collins, J. J. et Walker, G. C. (2014). Rôle central de la RNase YbeY dans la régulation des petits ARN Hfq-dépendante et Hfq-indépendante chez les bactéries. BMC Génomique 15:121. doi: 10.1186/1471-2164-15-121

Pandey, S.P., Minesinger, B.K., Kumar, J. et Walker, G.C. (2011). Une protéine hautement conservée de fonction inconnue dans Sinorhizobium meliloti affecte la régulation de l'ARNs similaire à Hfq. Acides nucléiques Res. 39, 4691�. doi: 10.1093/nar/gkr060

Patterson-Fortin, L. M., Vakulskas, C. A., Yakhnin, H., Babitzke, P. et Romeo, T. (2013). Double régulation post-transcriptionnelle via un leader d'ARNm sensible au cofacteur. J. Mol. Biol. 425, 3662�. doi: 10.1016/j.jmb.2012.12.010

Perez-Rueda, E., et Martinez-Nu༞z, M.A. (2012). Le répertoire des facteurs de transcription liant l'ADN chez les procaryotes : enseignements fonctionnels et évolutifs. Sci. Programme. 95, 315�. doi: 10.3184/003685012X13420097673409

Phadtare, S., Inouye, M. et Severinov, K. (2002). L'activité de fusion des acides nucléiques de Escherichia coli La CspE est essentielle pour l'antiterminaison de la transcription et l'acclimatation au froid des cellules. J. Biol. Chem. 277, 7239&# x020137245. doi: 10.1074/jbc.M111496200

Picard, F., Dressaire, C., Girbal, L., et Cocaign-Bousquet, M. (2009).Examen des régulations post-transcriptionnelles chez les procaryotes par la biologie intégrative. C.R. Biol. 332, 958�. doi: 10.1016/j.crvi.2009.09.005

Rabhi, M., Espéli, O., Schwartz, A., Cayrol, B., Rahmouni, A. R., Arluison, V., et al. (2011). Le chaperon d'ARN de type Sm Hfq médie l'antiterminaison de la transcription au niveau des terminateurs Rho-dépendants. EMBO J. 30, 2805�. doi: 10.1038/emboj.2011.192

Ramesh, A., DebRoy, S., Goodson, J. R., Fox, K. A., Faz, H., Garsin, D. A., et al. (2012). Le mécanisme de reconnaissance de l'ARN par les régulateurs ANTAR de l'expression des gènes. PLoS Genet. 8 : e1002666. doi: 10.1371/journal.pgen.1002666

Rasmussen, A. A., Eriksen, M., Gilany, K., Udesen, C., Franch, T., Petersen, C., et al. (2005). Régulation de la stabilité de l'ARNm ompA : le rôle d'un petit ARN régulateur dans le contrôle dépendant de la phase de croissance. Mol. Microbiole. 58, 1421�. doi: 10.1111/j.1365-2958.2005.04911.x

Régnier, P., et Hajnsdorf, E. (2013). L'interaction de Hfq, de la poly(A) polymérase I et des exoribonucléases aux extrémités 3’ des ARN résultant de la terminaison Rho-indépendante : un modèle provisoire. ARN Biol. 10, 602�. doi: 10.4161/rna.23664

Reimmann, C., Valverde, C., Kay, E. et Haas, D. (2005). Répression post-transcriptionnelle des gènes contrôlés par GacS / GacA par la protéine de liaison à l'ARN RsmE agissant conjointement avec RsmA dans la souche de biocontrôle Pseudomonas fluorescens CHA0. J. Bactériol. 187, 276&# x02013285. doi: 10.1128/JB.187.1.276

Rieder, R., Reinhardt, R., Sharma, C. et Vogel, J. (2012). Des outils expérimentaux pour identifier les interactions ARN-protéine dans Helicobacter pylori. ARN Biol. 9, 520&# x02013531. doi: 10.4161/rna.20331

Romeo, T., Vakulskas, C. A. et Babitzke, P. (2013). Régulation post-transcriptionnelle à l'échelle mondiale : forme et fonction des systèmes Csr/Rsm. Environ. Microbiole. 15, 313�. doi: 10.1111/j.1462-2920.2012.02794.x

Rutberg, B. (1997). MicroReview antiterminaison de la transcription des opérons cataboliques. Mol. Microbiole. 23, 413&# x02013421. doi: 10.1046/j.1365-2958.1997.d01-1867.x

Said, N., Rieder, R., Hurwitz, R., Deckert, J., Urlaub, H. et Vogel, J. (2009). Expression et purification in vivo de petits régulateurs d'ARN marqués par des aptamères. Acides nucléiques Res. 37, e133. doi: 10.1093/nar/gkp719

Salvail, H., Caron, M.-P., Bélanger, J., et Massé, E. (2013). Des fonctions antagonistes entre l'ARN chaperon Hfq et un ARNs régulent la sensibilité à l'antibiotique colicine. EMBO J. 32, 2764�. doi: 10.1038/emboj.2013.205

Santangelo, T. J. et Artsimovitch, I. (2011). Terminaison et anti-terminaison : l'ARN polymérase exécute un panneau d'arrêt. Nat. Rév. Microbiol. 9, 319&# x02013329. doi: 10.1038/nrmicro2560

Saramago, M., Bárria, C., Dos Santos, R. F., Silva, I. J., Pobre, V., Domingues, S., et al. (2014). Le rôle des RNases dans la régulation des petits ARN. Cour. Avis. Microbiole. 18, 105�. doi: 10.1016/j.mib.2014.02.009

Sarsero, J.P., Merino, E. et Yanofsky, C. (2000). UNE Bacillus subtilis Le gène de fonction auparavant inconnue, yhaG, est régulé par la traduction par TRAP activé par le tryptophane et semble être impliqué dans le transport du tryptophane. J. Bactériol. 182, 2329&# x020132331. doi: 10.1128/JB.182.8.2329-2331.2000

Sauer, E. (2013). Structure et propriétés de liaison à l'ARN de la protéine bactérienne LSm Hfq. ARN Biol. 10, 610�. doi: 10.4161/rna.24201

Sauer, E., Schmidt, S. et Weichenrieder, O. (2012). Petit ARN se liant à la surface latérale des hexamères Hfq et réarrangements structurels lors de la reconnaissance de la cible de l'ARNm. Proc. Natl. Acad. Sci. ETATS-UNIS. 109, 9396�. doi: 10.1073/pnas.1202521109

Schiano, C.A., et Lathem, W.W. (2012). Régulation post-transcriptionnelle de l'expression des gènes dans Yersinia espèce. Devant. Cellule. Infecter. Microbiole. 2:129. doi: 10.3389/fcimb.2012.00129

Schnetz, K., et Rak, B. (1988). Régulation de l'opéron bgl de Escherichia coli par antiterminaison transcriptionnelle. EMBO J. 7, 3271�.

Schumacher, M.A., Pearson, R.F., Møller, T., Valentin-Hansen, P. et Brennan, R.G. (2002). Structures du régulateur traductionnel pléiotrope Hfq et d'un complexe Hfq-ARN : une protéine bactérienne de type Sm. EMBO J. 21, 3546�. doi: 10.1093/emboj/cdf322

Shahbabian, K., Jamalli, A., Zig, L. et Putzer, H. (2009). La RNase Y, une nouvelle endoribonucléase, initie le renouvellement du riboswitch dans Bacillus subtilis. EMBO J. 28, 3523&# x020133533. doi: 10.1038/emboj.2009.283

Sheidy, D.T. et Zielke, R.A. (2013). Analyse et élargissement du rôle du Escherichia coli protéine ProQ. PLoS UN 8:e79656. doi: 10.1371/journal.pone.0079656

Shine, J., et Dalgarno, L. (1974). La séquence 3’-terminal de Escherichia coli ARN ribosomique 16S : complémentarité des triplets non-sens et des sites de liaison du ribosome. Proc. Natl. Acad. Sci. ETATS-UNIS. 71, 1342&# x020131346. doi: 10.1073/pnas.71.4.1342

Smaldone, G.T., Antelmann, H., Gaballa, A. et Helmann, J.D. (2012). L'ARNs FsrA et la protéine FbpB interviennent dans l'induction dépendante du fer de la Bacillus subtilis lutABC oxydases contenant du fer et du soufre. J. Bactériol. 194, 2586�. doi: 10.1128/JB.05567-11

Snyder, D., Lary, J., Chen, Y., Gollnick, P. et Cole, J. L. (2004). Interaction de la protéine d'atténuation de liaison à l'ARN trp (TRAP) avec l'anti-TRAP. J. Mol. Biol. 338, 669�. doi: 10.1016/j.jmb.2004.03.030

Sobrero, P., et Valverde, C. (2012). La protéine bactérienne Hfq : bien plus qu'un simple facteur de liaison à l'ARN. Critique. Rév. Microbiol. 38, 276�. doi: 10.3109/1040841X.2012.664540

Sonnleitner, E., Abdou, L. et Haas, D. (2009). Le petit ARN comme régulateur global de la répression des catabolites du carbone chez Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. ETATS-UNIS. 106, 21866&# x0201321871. doi: 10.1073/pnas.pnas.0910308106

Sonnleitner, E., et Bläsi, U. (2014). Régulation de Hfq par l'ARN CrcZ en Pseudomonas aeruginosa répression des catabolites du carbone. PLoS Genet. 10 : e1004440. doi: 10.1371/journal.pgen.1004440

Soper, T.J., Doxzen, K. et Woodson, S.A. (2011). Rôle majeur pour la liaison et la restructuration de l'ARNm dans le recrutement des ARNs par Hfq. ARN 17, 1544&# x020131550. doi: 10.1261/rna.2767211

Sorger-Domenigg, T., Sonnleitner, E., Kaberdin, V. R. et Bläsi, U. (2007). Sites de liaison distincts et chevauchants de Pseudomonas aeruginosa Protéines Hfq et RsmA sur l'ARN non codant RsmY. Biochimie. Biophys. Rés. Commun. 352, 769�. doi: 10.1016/j.bbrc.2006.11.084

Sterzenbach, T., Nguyen, K.T., Nuccio, S.-P., Winter, M.G., Vakulskas, C.A., Clegg, S., et al. (2013). Un nouveau mécanisme de titrage de la CsrA régule l'expression du gène fimbrial dans Salmonelle typhimurium. EMBO J. 32, 2872�. doi: 10.1038/emboj.2013.206

Storz, G., Vogel, J. et Wassarman, K. M. (2011). Régulation par les petits ARN dans les bactéries : des frontières en expansion. Mol. Cellule 43, 880�. doi: 10.1016/j.molcel.2011.08.022

St&# x000FClke, J. (2002). Contrôle de la terminaison de la transcription chez les bactéries par des protéines de liaison à l'ARN qui modulent les structures de l'ARN. Cambre. Microbiole. 177, 433&# x02013440. doi: 10.1007/s00203-002-0407-5

Subramanian, A.R. (1983). Structure et fonctions de la protéine ribosomique S1. Programme. Acide nucléique Res. Mol. Biol. 28, 101�. doi: 10.1016/S0079-6603(08)60085-9

Suzuki, K., Babitzke, P., Kushner, S.R. et Romeo, T. (2006). Identification d'une nouvelle protéine régulatrice ( CsrD ) qui cible les ARN régulateurs mondiaux CsrB et CsrC pour la dégradation par la RNase E. Gènes Dev. 20, 2605�. doi: 10.1101/gad.1461606

Tortosa, P., Lindner, C., Saier, M. H., Reizer, J. et Le Coq, D. (1997). Phosphorylation multiple de SacY, un Bacillus subtilis antiterminateur transcriptionnel contrôlé négativement par le système phosphotransférase. J. Biol. Chem. 272, 17230&# x0201317237. doi: 10.1074/jbc.272.27.17230

Tsai, B. P., Wang, X., Huang, L. et Waterman, M. L. (2011). Profilage quantitatif de complexes ARN-protéines assemblés in vivo à l'aide d'une nouvelle approche protéomique intégrée. Mol. Protéomique cellulaire 10, M110.007385. doi: 10.1074/mcp.M110.007385

Tsui, H.C., Leung, H.C. et Winkler, M.E. (1994). Caractérisation des phénotypes largement pléiotropes causés par une mutation d'insertion hfq dans Escherichia coli K&# x0201312. Mol. Microbiole. 13, 35�. doi: 10.1111/j.1365-2958.1994.tb00400.x

Vecerek, B., Moll, I. et Bläsi, U. (2005). Autocontrôle translationnel du Escherichia coli gène chaperon de l'ARN hfq. ARN 11, 976�. doi: 10.1261/rna.2360205

Vercruysse, M., Köhrer, C., Davies, B.W., Arnold, M.F.F., Mekalanos, J.J., RajBhandary, U.L., et al. (2014). La RNase bactérienne hautement conservée YbeY est essentielle dans le vibrion cholérique, jouant un rôle essentiel dans la virulence, la régulation du stress et le traitement de l'ARN. Pathog PLoS. 10 : e1004175. doi: 10.1371/journal.ppat.1004175

Vogel, J., et Luisi, B. F. (2011). Hfq et sa constellation d'ARN. Nat. Rév. Microbiol. 9, 578�. doi: 10.1038/nrmicro2615

Vytvytska, O., Moll, I., Kaberdin, V. R., Von Gabain, A. et Bläsi, U. (2000). la liaison Hfq ( HF1 ) stimule la dégradation de l'ARNm de l'ompA en interférant avec la liaison du ribosome. Gènes Dev. 14, 1109�. doi: 10.1101/gad.14.9.1109

Wang, M.-C., Chien, H.-F., Tsai, Y.-L., Liu, M.-C. et Liaw, S.-J. (2014). L'ARN chaperon Hfq est impliqué dans la tolérance au stress et la virulence chez les uropathogènes Proteus mirabilis. PLoS UN 9:e85626. doi: 10.1371/journal.pone.0085626

Wang, X., Dubey, A.K., Suzuki, K., Baker, C.S., Babitzke, P. et Romeo, T. (2005). CsrA réprime post-transcriptionnellement pgaABCD, responsable de la synthèse d'un biofilm polysaccharidique adhésine de Escherichia coli. Mol. Microbiole. 56, 1648�. doi: 10.1111/j.1365-2958.2005.04648.x

Weilbacher, T., Suzuki, K., Dubey, A. K., Wang, X., Gudapaty, S., Morozov, I., et al. (2003). Un nouveau composant ARNs du système de régulation du stockage du carbone de Escherichia coli. Mol. Microbiole. 48, 657�. doi: 10.1046/j.1365-2958.2003.03459.x

Windbichler, N., von Pelchrzim, F., Mayer, O., Csaszar, E. et Schroeder, R. (2008). Isolement de petites protéines de liaison à l'ARN d'E. coli : preuve d'interaction fréquente des ARN avec l'ARN polymérase. ARN Biol. 5, 30�. doi: 10.4161/rna.5.1.5694

Yakhnin, A.V, Baker, C.S., Vakulskas, C.A., Yakhnin, H., Berezin, I., Romeo, T., et al. (2014). CsrA active l'expression de flhDC en protégeant l'ARNm de flhDC du clivage médié par la RNase E. Mol. Cellule 87, 851&# x02013866. doi: 10.1111/mmi.12136.CsrA

Yakhnin, H., Baker, C. S., Berezin, I., Evangelista, M. A., Rassin, A., Romeo, T., et al. (2011a). CsrA réprime la traduction de sdiA, qui code pour le récepteur N-acylhomosérine-L-lactone de Escherichia coli, en se liant exclusivement dans la région codante de l'ARNm sdiA. J. Bactériol. 193, 6162&# x020136170. doi: 10.1128/JB.05975-11

Yakhnin, H., Yakhnin, A.V., Baker, C.S., Sineva, E., Berezin, I., Romeo, T., et al. (2011b). Régulation complexe du gène régulateur global csrA : répression traductionnelle médiée par CsrA, transcription à partir de cinq promoteurs par Esigma70 et EsigmaS, et activation transcriptionnelle indirecte par CsrA. Mol. Microbiole. 81, 689�. doi: 10.1111/j.1365-2958.2011.07723.x

Yakhnin, H., Zhang, H., Yakhnin, A.V. et Babitzke, P. (2004). La protéine d'atténuation de liaison à l'ARN trp de Bacillus subtilis régule la traduction du gène de transport du tryptophane trpP ( yhaG ) en bloquant la liaison au ribosome. J. Bactériol. 186, 278�. doi: 10.1128/JB.186.2.278

Yang, M., de Saizieu, A., van Loon, A.P. et Gollnick, P. (1995). Traduction de trpG en Bacillus subtilis est régulée par la protéine d'atténuation de liaison à l'ARN trp (TRAP). J. Bactériol. 177, 4272�.

Zha, D., Xu, L., Zhang, H. et Yan, Y. (2014). Le système GacS-GacA à deux composants active la traduction lipA par RsmE mais pas RsmA dans Pseudomonas les protéines Pf-5. Appl. Environ. Microbiole. 80, 6627�. doi: 10.1128/AEM.02184-14

Zhang, A., Wassarman, K. M., Ortega, J., Steven, A. C. et Storz, G. (2002). La protéine Hfq de type Sm augmente l'interaction de l'ARN OxyS avec les ARNm cibles. Mol. Cellule 9, 11�. doi: 10.1016/S1097-2765(01)00437-3

Mots clés : régulation post-transcriptionnelle, protéines liant l'ARN, bactéries, mécanismes de fonctionnement, applications biotechnologiques, régulation de la traduction, régulation de la stabilité

Citation : Van Assche E, Van Puyvelde S, Vanderleyden J et Steenackers HP (2015) Protéines liant l'ARN impliquées dans la régulation post-transcriptionnelle chez les bactéries. Devant. Microbiole. 6:141. doi: 10.3389/fmicb.2015.00141

Reçu : 24 décembre 2014 Document en attente publié : 24 janvier 2015
Accepté : 06 février 2015 Mise en ligne : 03 mars 2015.

Martin G. Klotz, Université de Caroline du Nord à Charlotte, États-Unis

Brian Stevenson, Université du Kentucky, États-Unis
Paul Babitzke, Penn State University, États-Unis

Copyright © 2015 Van Assche, Van Puyvelde, Vanderleyden et Steenackers. Il s'agit d'un article en libre accès distribué sous les termes de la Creative Commons Attribution License (CC BY). L'utilisation, la distribution ou la reproduction dans d'autres forums est autorisée, à condition que le ou les auteurs originaux ou le concédant de licence soient crédités et que la publication originale dans cette revue soit citée, conformément à la pratique académique acceptée. Aucune utilisation, distribution ou reproduction non conforme à ces conditions n'est autorisée.


Voir la vidéo: De lADN à lARNm (Août 2022).